Mir 494 mimic

MiRNA oligonucleotides, including miR‐494 mimic (5′‐UGAAACAUACACGGGAAACCUCU‐3′), miR‐494 inhibitor (5′‐AGAGGUUUCCCGUGUAUGUUUCA‐3′), and their respective scrambled negative control (NC): mimic NC (5′‐UUCUCCGAACGUGUCACGUTT‐3′) and inhibitor NC (5′‐CAGUACUUUUGUGUGUAGUACAA‐3′), were purchased from Shanghai GenePharma Co., Ltd. The final concentration of miRNA oligonucleotides for transfection was 100 nM, and the transfection reagent was Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Thirty hours after transfection, cells were collected for subsequent experiments. Each group had three samples and each sample was repeated three times (n = 3).

The wild-type 3′-untranslated region (3′-UTR) of CDK6 containing the miR-494 binding site was cloned into the pGL3-control vector (Ambion; Thermo Fisher Scientific, Inc.) to construct the CDK6-3′-UTR-wild-type (WT). The CDK6 3′-UTR mutations containing mutant (mut) sequences were obtained using a QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, Inc., Palo Alto, CA, USA). All plasmids were confirmed by sequencing. The miR-494 mimics were generated by Shanghai GenePharma Co., Ltd. (Shanghai, China) and the scramble sequence was purchased from Ambion; Thermo Fisher Scientific, Inc. Briefly, the MG-63 (~2–3×10⁶) and U2OS cells (~2–3×10⁶) were seeded into a 24-well plate 1 day prior to transfection, and then co-transfected with miR-494 mimics (sense, 5′UGA AAC AUA CAC GGG AAA CCU C3′ and antisense, 5′GGU UUC CCG UGU AUG UUU CAU U3′; 100 nM) or scramble (sense, 5′UUC UCC GAA CGU GUC ACG UUU 3′ and antisense, 5′ACG UAC ACG UUC GGA GAA UU3′; 50 nM), in addition to the CDK6-3′-UTR-WT or CDK6-3′-UTR-mutusing Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). After 48 h, the luciferase activity was determined using a Dual-Luciferase reporter assay (Promega Corporation, Madison, WI, USA), which was normalized to the activity of Renilla luciferase.