Nasopharyngeal viral loads were determined using RdRp-IP4 RT–qPCR designed at the Institut Pasteur (National Reference Center for Respiratory Viruses) to target a section of the RdRP gene based on the first sequences of SARS-CoV-2 made available on the Global Initiative on Sharing All Influenza Data database on 11 Jan 2020 (ref. 51 (link)). Primer and probe sequences were: nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG; nCoV_IP4-14146Rv CTGGTCAAGGTTAATATAGG; nCoV_IP4-14084Probe+ TCATACAAACCACGCCAGG [5′]Fam [3′]BHQ-1. All positive samples were quantified using a standard curve and expressed as the number of RNA copies per ml. Mucin levels were analyzed using a MUC5AC ELISA Kit (NBP2-76703, Novus Biologicals). Data were collected with the Multiskan Spectrum (Thermo Fisher Scientific).
Muc5ac elisa kit
Manufactured by Novus Biologicals
Sourced in United States
The MUC5AC ELISA Kit is a quantitative sandwich enzyme-linked immunosorbent assay (ELISA) designed for the measurement of MUC5AC levels in biological samples. MUC5AC is a secreted mucin glycoprotein that plays a role in mucus production and barrier function. The kit utilizes a specific antibody coated on the plate to capture MUC5AC, and a detection antibody conjugated to a reporter enzyme for quantification.
Automatically generated - may contain errors
3 protocols using muc5ac elisa kit
1
Quantification of SARS-CoV-2 Viral Loads and Mucin Levels
2
Lysophosphatidylserine Regulates EGFR and Mucin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NCI-H292 cells were preincubated with EGFR-neutralizing antibodies for 30 min and then stimulated with LysoPS for different periods of time. Culture supernatants were collected and the level of TGF-α was measured by a TGF-α ELISA kit (Abcam, Cambridge, UK). To measure the production of MUC5AC, NHBE cells were incubated with LysoPS for 8 h, and the culture supernatants were analyzed by a MUC5AC ELISA kit (Novus Biologicals, Littleton, CO, USA).
3
Comprehensive Isotyping and Cytokine Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total IgA, IgM, IgG1, IgG2, IgG3, and IgG4 were determined by using the Bio-Plex Pro Human Isotyping Assay Panel (Bio-Rad). Data were acquired on a Bio-Plex 200 System (Bio-Rad) and analyzed with Bio-Plex Manager version 5 (Bio-Rad). IgA1 and IgA2 subclasses were measured by Simoa (Quanterix). Total IgD were determined by using an enzyme-linked immunosorbent assay (ELISA) kit (MBS564048; MyBioSource). Total IgE was determined by using an ELISA kit (88-50610; Invitrogen). Data were collected with the Multiskan Spectrum (Thermo Fisher Scientific).
Cytokines were quantified by Simoa Cytokine 3-Plex B, Discovery, or Advantage Kits (Quanterix) except interferon-γ and interleukin-17F (IL-17F), which used Quanterix Homebrew assays. Nasopharyngeal mucin levels were analyzed by using an MUC5AC ELISA kit (NBP2-76703; Novus Biologicals; diluted 1/50). Eosinophil cationic protein was determined for swabs medium using an ELISA kit (MBS2602477; MyBioSource; diluted 1/2). Total protein content of the supernatants was calculated by using the Bradford method.15 (link)
Cytokines were quantified by Simoa Cytokine 3-Plex B, Discovery, or Advantage Kits (Quanterix) except interferon-γ and interleukin-17F (IL-17F), which used Quanterix Homebrew assays. Nasopharyngeal mucin levels were analyzed by using an MUC5AC ELISA kit (NBP2-76703; Novus Biologicals; diluted 1/50). Eosinophil cationic protein was determined for swabs medium using an ELISA kit (MBS2602477; MyBioSource; diluted 1/2). Total protein content of the supernatants was calculated by using the Bradford method.15 (link)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!