T7 and sp6 rna polymerase

A fragment of ROMKa (kcnj1a, Ensemble ID: ENSORLG00000013560) was obtained by a PCR and inserted into the pGEM-T Easy vector. Specific forward and reverse primers were 5′-CCTTCCTGGCTGACTTCTG-3′ and 5′-GCTCCAATGAGGGACTGTATGA-3′. The inserted fragments were amplified with the T7 and SP6 primers by a PCR, and the products were respectively used as templates for in vitro transcription with T7 and SP6 RNA polymerase (Roche, Penzberg, Germany). Digoxigenin (DIG)-labeled RNA probes were examined using RNA gels and a dot blot assay to confirm their quality and concentrations.

RNA pull‐down assays were conducted as previously described [34]. Briefly, LINC01578 and antisense LINC01578 were in vitro‐transcribed and biotin‐labeled from pSPT19‐LINC01578 by the Biotin RNA Labeling Mix (Roche) and T7 and Sp6 RNA polymerase (Roche), respectively. After being purified, 3 µg of in vitro‐transcribed LINC01578 was incubated with 1 mg of whole‐cell lysate of DLD‐1 cells at 25 °C for 1 h. Next, the complexes were enriched by streptavidin agarose beads (Invitrogen). The proteins present in the pull‐down material were measured using western blot.

A fragment of AE1a (slc4a1a) and AE1b (slc4a1b) were obtained by PCR and inserted separately into the pGEM-T Easy vector. The primer sequences of target genes were as follows: (slc4a1a: F-5′ GGAGTCTCAGATTACCACGCT 3′, R-5′ ATCATCTCCAGGTTCGTCGTCAAAT 3′; slc4a1b: F-5′ TGGATGTTTCTTTATTGCCTTTT 3′, R-5′ TCATTTGGATGGTATTTCTTTGG 3′). The inserted fragments were amplified with the T7 and SP6 primers by PCR, and the products were respectively used as templates for in vitro transcription with T7 and SP6 RNA polymerase (Roche, Penzberg, Germany). Digoxigenin (DIG)-labeled RNA probes were examined using RNA gels and dot blot assays to confirm their quality and concentrations.

Contig sequences for the investigated genes were identified in the transcriptome dataset by bidirectional BLAST [24 (link)]. Whole transcripts or fragments were amplified by PCR with specific primers (Fw = AGTTTGGGATGGTGGG, Rv = TTCTGGGCTAGCTGGT) from cDNA prepared with SuperScript III (Invitrogen, Waltham, MA, USA), ligated into pgemT-easy vector (Promega, Madison, WI, USA) and cloned into Top10 chemically competent Escherichia coli (Invitrogen). Clone sequences were verified by Sanger sequencing. DIG-labelled sense and antisense RNA probes were generated from plasmid DNA with T7- and SP6-RNA polymerases (Roche, Madison, WI, USA).

In situ hybridization of maize PR with digoxigenin-labeled probes was performed as described by Trevisan et al. (2011) (link). GRMZM2G145008 was amplified as probe in PCR using the primers listed in Supplementary Table S1. The fragment was cloned into the T-easy vector (Madison, WI, USA) for labeling. The sense and antisense probes were synthesized in vitro using T7 and SP6 RNA polymerases (Roche, Basel, Switzerland) and labeled with digoxygenin (DIG) RNA labeling mix (Roche, Basel, Switzerland) following the manufacturer’s protocol. Root tissues were fixed overnight in RNase-free 4% formaldehyde. Samples were dehydrated in a graded ethanol series, embedded in Paraplast Plus (Sigma, St Louis, MO, USA) and sectioned (7 μm) as described previously (Trevisan et al., 2011 (link)). After hybridization and staining, slides were observed with an Olympus BX50 microscope (Olympus Corporation, Tokyo, Japan). Images were captured with an Axiocam Zeiss MRc5 color camera (Carl Zeiss, Oberkochen, Germany), and processed with Adobe Photoshop 6.0.

Contig sequences for the investigated genes were identified in the transcriptome data set by bidirectional blast. Whole transcripts or fragments were amplified by PCR with specific primers from cDNA prepared with SuperScript III (Invitrogen), ligated into pgemT-easy vector (Promega) and cloned into Top10 chemically competent E. coli (Invitrogen). Clone sequences were verified by Sanger sequencing and the Las-r-opsin sequence was elongated by Rapid amplification of cDNA ends with the SMARTer RACE cDNA Amplification KIT (Clontech). DIG- and FITC-labeled sense and antisense RNA probes were generated from plasmid DNA with Megascript Kit (Ambion) or with T7- and SP6-RNA Polymerases (Roche).

The assembly of Illumina (San Diego, California, RRID:SCR_010233) HISeq RNA-seq data of 2–11d old larval material described by Vöcking et al. (2015 (link)) was used to identify transcripts of interest via bidirectional blast. Whole transcripts and fragments were then amplified by PCR using gene-specific primers and cDNA prepared with Super Script II (Thermo Fisher Scientific, Waltham, Massachusetts) RRID:SCR_008452), subsequently ligated into pgemT-easy vector (Promega, Madison, Wisconsin, RRID:SCR_006724) and cloned into Top10 chemically competent E. coli (Thermo Fisher Scientific). Sanger sequencing was used to verify the cloned sequences before DIG- and FITC-labeled sense and antisense probes were generated with T7- and SP6-RNA Polymerases (Roche, Basel, Switzerland, RRID:SCR_001326) or with the Megascript Kit (Thermo Fisher Scientific).