The hBMSC-TERT+Bone and hBMSC-TERT–Bone cells were transduced with a retroviral vector containing the firefly luciferase gene (Luc2) producing luciferase-containing hBMSC-TERT (hBMSC-TERT-Luc). The luciferase reporter gene luc2 (Photinus pyralis) was subcloned into the retroviral vector pBABE-puro (addgene Plasmid 1764). Retroviral vector was transfected into the Phoenix-AMPHO packaging cells (CRL-3213™; ATCC), and cultured in Dulbecco’s modified Eagle’s medium (DMEM) medium (Gibco, Invitrogen, Herlev, Denmark) supplemented with 10 % FCS until 70–80 % confluent, using the FuGENE 6 (Roche, Hvidovre, Denmark) reagent according to the manufacturer’s instruction. For cell transduction, the supernatants collected from Phoenix packaging cells containing virus particles were filtered with a 0.45 μm filter and added to hBMSC-TERT cell lines in the presence of Polybrene (Sigma, Brøndby, Denmark). Stably transduced cells were selected on the antibiotic puromycine.
Phoenix ampho packaging cells
Manufactured by American Type Culture Collection
Sourced in Denmark, United States
The Phoenix-AMPHO packaging cells are a laboratory equipment product designed for the production of retroviral particles. These cells serve as a platform for the generation of recombinant retroviruses, which can be used in various research applications. The core function of the Phoenix-AMPHO packaging cells is to provide the necessary components for the packaging and release of retroviral particles.
Automatically generated - may contain errors
Lab products found in correlation
Dmem medium, by Thermo Fisher Scientific (1 mentions)
Polybrene, by Merck Group (1 mentions)
Lenti x 293t cells, by Takara Bio (1 mentions)
Pcmv vsv g, by Addgene (1 mentions)
Pcmv dr8.2 dvpr, by Addgene (1 mentions)
Jetprime, by Polyplus Transfection (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Facsaria 3, by BD (1 mentions)
Pmko 1 puro p53 shrna2, by Addgene (1 mentions)
Pmko 1 puro gfp shrna, by Addgene (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Psuper retro puro vector, by Oligoengine (1 mentions)
6 protocols using phoenix ampho packaging cells
1
Luciferase-Labeled hBMSC-TERT Cell Lines
2
Lentivirus and Retrovirus Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For lentivirus production, Lenti-X 293 T cells (Clontech) were transfected at 90% confluence with JetPRIME (Polyplus). Packaging plasmids pCMV-dR8.2 dvpr (addgene # 8455) and pCMV-VSV-G (addgene #8454) were used. For retroviral production, Phoenix-AMPHO packaging cells (ATCC CRL-3213) were used.
3
Generating Replication-Incompetent Retroviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phoenix Ampho packaging cells (ATCC) were used to generate replication‐incompetent retroviruses as previously described.29 Following retroviral infection, cells were maintained in media containing G418 (Wisent) for at least 7 days.
4
Generation of 5T33-OVA Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5T33-OVA cell line (Ministère de l'enseignement supérieur et de la recherche, agreement n° 5663) was produced by modification of the original 5T33 murine MM cell line [34 (link),35 (link)] kindly provided by Dr. Harvey Turner (Department of Nuclear Medicine, Fremantle Hospital, Western Australia) with the permission of Dr. J. Radl (TNO Institute, Leiden, The Netherlands). A sequence containing the cDNA coding for cytoplasmic Ovalbumin was obtained by BamHI-EcoRI digestion of the cytoplasmic Ovalbumin vector (Addgene). The fragment was cloned into BamHI and EcoRI sites of the retroviral vector pMX [36 (link)]. Phoenix-Ampho packaging cells (ATCC® CRL-3213) were then transiently transfected with the ovalbumin retroviral construct, supernatants were collected and used to transduced 5T33 cells. Three days after retroviral transduction, 5T33-OVA cells were sorted by flow cytometry (FACS ARIA III, BD) by using mAb 25-D1.16 (eBioscience), specific for H2Kb /OVA257–264 (SIINFEKL) complexes.
5T33-OVA cells were cultured in RPMI1640 medium (Gibco) containing 2 mM L-glutamine, and 10% heat-inactivated fetal calf serum (PAA) and were incubated at 37°C, 5% CO2, 95% humidity. Aliquots of early passaged cells were frozen in 10% dimethylsulfoxide, 90% FCS and stored under liquid nitrogen.
5T33-OVA cells were cultured in RPMI1640 medium (Gibco) containing 2 mM L-glutamine, and 10% heat-inactivated fetal calf serum (PAA) and were incubated at 37°C, 5% CO2, 95% humidity. Aliquots of early passaged cells were frozen in 10% dimethylsulfoxide, 90% FCS and stored under liquid nitrogen.
5
Stable Knockdown Cell Line Generation
6
Generating Caco-2 Cells with PKG2 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A sequence beginning with an AA dinucleotide was chosen in the PKG2 mRNA, and we designed hairpin RNAi template oligonucleotides (shRNA). The control shRNA was generated from a scrambled sequence not targeting any known gene. The sequences (5'3') are as following: PKG2 AAGTGGAATACTATGACAAAG, scrambled GCATACTACCACTAGAGTTTA.
Retroviruses from pSUPER.retro.puro vector (OligoEngine, Seattle, WA, USA), expressing the shRNAs, were prepared by transient transfection in amphotropic Phoenix-AMPHO packaging cells (ATCC, Rockville, MD, USA). Caco-2 cells were infected with either shRNA or scramble expressing retroviruses and selected with puromycin (1 µg/ml). The acquired stable clones were called Caco-2 shRNA PKG2 and Caco-2 scrambled and the effect on PKG2 expression was assessed by immunoblotting using an anti-PKG2 antibody.
Retroviruses from pSUPER.retro.puro vector (OligoEngine, Seattle, WA, USA), expressing the shRNAs, were prepared by transient transfection in amphotropic Phoenix-AMPHO packaging cells (ATCC, Rockville, MD, USA). Caco-2 cells were infected with either shRNA or scramble expressing retroviruses and selected with puromycin (1 µg/ml). The acquired stable clones were called Caco-2 shRNA PKG2 and Caco-2 scrambled and the effect on PKG2 expression was assessed by immunoblotting using an anti-PKG2 antibody.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!