Bulge loop mirna rt pcr primer set

CDNA was synthesized from random hexamers and reverse-transcribed using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beiing, China). Gene expression levels were measured with RT-PCR using TransScript Top Greenq PCR SuperMix (TransGen, Beiing, China) in Piko Thermal Cycler 96-well system (Thermo, Waltham, MA, USA). Each sample was analyzed in triplicate. Relative levels of mRNA expression were normalized for β-actin mRNA expression and calculated according to the formula 2^{−(ΔCt sample-ΔCt control)}. Primer sequences for the genes: PTEN F: 5′-CCCAGTCAGAGGCGCTATG-3′, R: 5′-GGCAGACCACAAACTGAGGATT-3′; Akt F: 5′-CTCATTCCAGACCCAGAC-3′, R: 5′-CAGCCCGAAGTCCGTTA-3′; PI3K F: 5′-AACGAGAACGTGTGCCATTTG-3′, R: 5′-AGAGATTGGCATGCTGTCGAA-3′; β-actin F: 5′-CACCCGCGAGTACAACCTTC-3′, R: 5′-CCCATACCCACCATCACACC-3′ (Invitrogen, Carlsbad, CA, USA). micoRNA quantification was determined by using Bulge-loop miRNA RT-PCR Primer Set (one RT primer and a pair of PCR primers for each set) specific for miR-221, designed by RiboBio (RiboBio Co. Ltd., Guangzhou, China). The U6 gene was used as an internal control.

Total RNA was extracted using Trizol (Life Technologies, Carlsbad, CA, USA). For reverse transcription PCR (RT‐PCR), cDNA was obtained using the SuperScriptIII^® Frist‐Strand Synthesis System (Life Technologies). Gene expression was monitored by PCR assay. The primer sequences were as follows: sST2 forward, 5′‐ GGCACACCGTAAGACTAAGTAG‐3′ and sST2 reverse, 5′‐CAATTTAAGCAGCAGAGAAGCTCC‐3′; β‐actin forward, 5′‐CCCAGCCATGTACGTTGCTAT‐3′ and β‐actin reverse, 5′‐TCACCGGAGTCCATCACGAT ‐3′. Levels of miR‐202‐3p and U6 were monitored by quantitative RT‐PCR using the Bulge‐Loop™ miRNA RT‐PCR primer set (RiboBio Co., Ltd. Guangzhou, China).

The total RNA of cells and tissues was extracted by Life Trizol (Ambion, USA) according to the instructions. The quality and concentration of RNA were detected by NanoDrop 2000 (Thermo Fisher Scientific, USA) and cDNA was reversed transcribed with the ReverTra Ace^® quantitative real-time PCR (qPCR) RT Kit (Toyobo, Osaka, Japan). Bulge-Loop™ miRNA RT-PCR Primer Sets and U6 primers were purchased from Guangzhou Ribobio, China. qRT-PCR was performed by UltraSYBR Mixture (CWbio, Beijing, China). The relative levels of miRNAs and genes were normalized by U6 and GAPDH separately. The gene primers (Tsingke, Wuhan, China) are listed in Table 1.