Total RNA was extracted from BV2 microglial cells or ipsilateral brain hemispheres using RNAiso plus (Takara, Kusatsu, Japan). For brain sampling, mice were perfused with autoclaved PBS and their brains were removed. Total RNA (1 µg) was used to generate cDNA by reverse transcription using All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). Then mRNA expression levels of M1 and M2 polarization markers were determined using StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster city, CA, USA) with FG Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and specific primer sets (Supplementary Table 1 ). Expression levels of target genes were quantified using the 2−ΔΔCT method relative to β-actin.
Steponeplustm qrt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The StepOnePlus™ qRT-PCR system is a real-time PCR instrument designed for gene expression analysis and other quantitative PCR applications. It features a compact design and supports both standard and fast PCR protocols.
Automatically generated - may contain errors
Lab products found in correlation
Rnaiso plus, by Takara Bio (5 mentions)
All in one first strand cdna synthesis supermix, by Transgene (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Fg power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Simpliamp thermal cycler, by Thermo Fisher Scientific (1 mentions)
Reverse transcriptase, by Agilent Technologies (1 mentions)
Rnase inhibitor, by Agilent Technologies (1 mentions)
Tri reagent, by Merck Group (1 mentions)
6 protocols using steponeplustm qrt pcr system
1
Analyzing M1 and M2 Microglial Polarization
2
Brain Hemisphere Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the ipsilateral brain hemisphere using RNAiso Plus (Takara, Kusatsu, Japan). Total RNA (1 µg) was then used to synthesize cDNA with All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). qRT-PCR was carried out using a StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and corresponding primers (Table 1 ). The mRNA expression levels of target genes were quantified using the 2−ΔΔCT method and normalized to β-actin.
3
Quantifying LPA Receptor and Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Skin tissues were homogenized to extract total RNA using RNAiso plus (Takara, Kusatsu, Japan). StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) and FG Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) were used for qRT-PCR analysis. Expression levels of each LPA receptor were quantified using the 2−ΔΔCT method relative to 18S. To determine expression levels of pro-inflammatory cytokines (IL-1β, IL-17, and IL-23), semi-quantitative PCR was performed on a SimpliAmp Thermal cycler (Applied Biosystems) with AccuPower® Taq polymerase (Bioneer, Daejeon, Korea). Image J software (National Institute of Mental Health, Bethesda, MD, USA) was used to quantify specific PCR products. The following primer sets were used: LPA1 For: GCAGCACACATCCAGCAATA Rev: GTTCTGGACCCAGGAGGAAT, LPA2 For: TCAGCCTAGTCAAGACGGTTG Rev: CATCTCGGCAGGAATATACCAC, LPA3 For: ACACCAGTGGCTCCATCAG Rev: GTTCATGACGGAGTTGAGCAG, LPA4 For: AGGCATGAGCACATTCTCTC Rev: CAACCTGGGTCTGAGACTTG, LPA5 For: AGGAAGAGCAACCGATCACAG Rev: ACCACCATATGCAAACGATGTG, LPA6 For: TGTGAGATGGGCTGTCTCTG Rev: ACTGGGTTGAAGCCTTCCTT, IL-1β For: GCCTTGGGCCTCAAAGGAAAGAATC Rev: GGAAGACACAGATTCCATGGTGAAG, IL-17 For: GCTCCAGAAGGCCCTCAGACT Rev: CCAGCTTTCCCTCCGCATTGA, IL-23 For: CCCACAAGGACTCAAGGACAA Rev: AGTAGGGAGGTGTGAAGTTGC, and 18S For: CCATCCAATCGGTAGTAGCG Rev: GTAACCCGTTGAACCCCATT.
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from either the ipsilateral brain at one and three days after tMCAO challenge or BV2 cells using RNAiso plus (Takara, Kusatsu, Japan). For qRT-PCR, 1 µg of total RNA was reversely transcribed to synthesize cDNA using All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). qRT-PCR was performed using the StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and corresponding primers (primer sequences are listed in Table 1 ). The expression levels of the mRNAs were quantified using the 2−ΔΔCT method and then normalized to β-actin.
5
Quantifying RAGE Expression in Stroke
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the ipsilateral brain at 3 days after tMCAO challenge using RNAiso plus (1 mL, Takara, Kusatsu, Japan). For qRT-PCR, 1 µg of total RNA was used to synthesize cDNA using All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Haidian, China). qRT-PCR was carried out using a StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA) and primer sets for β-actin and RAGE. Target mRNA expression levels were then normalized with mouse β-actin and quantified using the 2−ΔΔCT method. Sequences of primers used in this study were as follows: β-actin forward, 5′-AGCCTTCCTTCTTGGGTATG-3′; β-actin reverse, 5′-CTTCTGCATCCTGTCAGCAA-3′; RAGE forward, 5′-ACGAGGATGAGGGCACCTATA-3′; and RAGE reverse, 5′-GTCGTTTTCGCCACAGGATAG-3′.
6
Gene Expression Profiling After tMCAO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ipsilateral brain hemisphere at 1 and 3 days after tMCAO challenge using TRI reagent (Sigma-Aldrich). For qRT-PCR, RNA (1 μg) was reverse-transcribed in a reaction mixture containing 3 mM MgCl2, 1 U RNase inhibitor, 0.5 mM dNTP, 1x RT buffer, 500 ng of random primers, and 10 U reverse transcriptase (Agilent, Santa Clara, CA, USA). The synthesized cDNA was used as a template for qRT-PCR using StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) and gene-specific primers (Supplementary Table 1 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!