Mx3005p

For qRT-PCR analysis of SDF1 and CXCR4 mRNA expression, total RNA from F_A7DOWN/P_A7UP, F_SHUS/P_NCEV and original F/P cells as well as normal liver cells in vitro and in vivo were extracted using Trizol reagent (Invitrogen, USA). Reverse transcription of purified RNA was performed using the PrimeScript1 RT reagent kit (Takara, Japan). Quantification of gene transcripts was performed by qRT-PCR (Fluorescence real-time quantitative PCR meter MX3005P, USA) using SYBR1 Premix Ex TaqTM II (Takara, Japan), and the levels were normalized to GAPDH as the internal control. Primer sequences (Takara, Japan) for SDF1, CXCR4 and GAPDH are listed in Table 2. MXP software was used to analyze the results. Differences in mRNA expression were calculated according to the^△△Ct method and displayed as 2(^—△△Ct).Table 2

Primer sequences for SDF1, CXCR4 and GAPDH

Sequence	Forward primer (5′ → 3′)	Reverse (5′ → 3′)
Gene name
SDF1	CCTGTGTGTCATGCCCTCTT	AGTCCAGCCTGCTATCCTCA
CXCR4	GTCAACCTCTAGAGCAGCGT	CTATCGGGGTAAAGGCGGTC
GAPDH	AAATGGTGAAGGTCGGTGTGAAC	CAACAATCTCCACTTTGCCACTG

On d 30 and 38, absolute quantitation of C. perfringens populations was carried out by quantitative real-time PCR (RT-PCR) assay. Genomic DNA was extracted from ileal digesta using the commercial QIAamp DNA stool kit (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations. Eluted DNA concentration was assessed with a NanoDrop^TM 2000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). After that, purified DNA samples were stored at −80 °C until analysis. The ileal C. perfringens numbers were enumerated, in duplicate, by SYBR-Green-I based RT-PCR assay performed on the Stratagene MX3005P RT-PCR machine using SYBR Premix Ex Taq™ kit (TaKaRa, Maebashi, Japan) following the manufacturer’s protocol. The primer pair; CPerf165F: 5′-CGCATAACGTTGAAAGATGG-3′ and CPerf269R: 5′-CCTTGGTAGGCCGTTACCC-3′ (Invitrogen, Mulgrave, VIC, Australia) targeting the 16S rRNA gene of C. perfringens was used [37 (link)]. Ten-fold serial dilutions of DNA extracted from pure C. perfringens cultures were done on the 96-well plate to generate a standard curve for RT-PCR. The concentration of C. perfringens in each sample was measured in terms of log¹⁰ CFU per gram of the ileal digesta.