Direct zoltm rna miniprep plus kit
The Direct-zol™ RNA Miniprep Plus Kit is a laboratory product designed for the efficient extraction and purification of total RNA from various biological samples. The kit utilizes a specialized lysis and binding buffer system to facilitate the direct isolation of RNA without the need for separate extraction steps. The purified RNA can be used for various downstream applications, such as gene expression analysis, RT-PCR, and RNA sequencing.
Lab products found in correlation
15 protocols using direct zoltm rna miniprep plus kit
Transcriptomics of Primary Cardiac Microvascular Endothelial Cells
Norovirus RNA Extraction and Detection
ZIKV mRNA Detection in Spleen
ZIKV mRNA detection was analyzed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) in the spleen. Viral RNA was extracted from spleen samples using the Direct-zolTM RNA Miniprep Plus Kit (Zymo Research) following the manufacturer’s protocol. Furthermore, RNA was converted to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem, Waltham, MA, USA). The RT-qPCR assay was prepared following SYBR Green JumpStart Taq ReadyMix (SIGMA) protocol using ZIKV-specific primers (5 pmol). Forward: 5′TTGGTCATGA TACTGCTGATTGC3′and Reverse: 5′CCTTCCACAAAGTCCCTATTGC3′ [30 (link)]. The RT-qPCR was carried out in an Applied Biosystem 7300 system for 40 cycles at 95 °C for 15 s and 60 °C for 1 min, and 1 cycle at 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s and 60 °C for 15 s. Each sample was analyzed in triplicates. Positive and negative template control was also included in all experiments.
Gastrocnemius Muscle RNA Sequencing
Quantitative RT-PCR Analysis of BAI Receptor Expression
Quantitative Analysis of mRNA Expression
RNA Extraction and Northern Blot Analysis
Biofilm RNA Extraction and qRT-PCR Analysis
Transcriptional Analysis of Biofilm Response to Myrtenol
Muscle Tissue RNA Extraction and Reverse Transcription
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!