Log In Sign up
The largest database of trusted experimental protocols

Nuclisens easymag 2.0 instrument

Manufactured by bioMérieux
Visit Supplier

The NucliSENS easyMAG 2.0 is a laboratory instrument designed for nucleic acid extraction. It utilizes a magnetic bead-based technology to isolate and purify DNA or RNA from a variety of sample types. The instrument automates the extraction process, providing consistent and reliable results.

Automatically generated - may contain errors

Lab products found in correlation

Cfx96 touch thermocycler, by Bio-Rad (3 mentions) Perfecta fastmix 2 low rox kit, by Quanta Biosciences (2 mentions) Qscript one step fast mgb qrt pcr kit, by Quanta Biosciences (1 mentions)

3 protocols using nuclisens easymag 2.0 instrument

1

Quantifying Viral DNA in EV Fractions

Check if the same lab product or an alternative is used in the 5 most similar protocols
200 μl aliquots of EV fraction, intermediate fraction, and HCMV fraction were subjected to nucleic acid extraction using a NucliSENS easyMAG 2.0 instrument (BioMérieux, Durham, NC). Quantitative real-time PCR (qPCR) was performed with a PerfeCTa FastMix II Low ROX kit (Quanta BioSciences, Gaithersburg, MD) using the following primer set: HHV-5 FWD: AACCAAGATGCAGGTGATAGG, HHV-5 REV: AGCG TGACGTGCATAAAGA, and the probe: /56-FAM/TACCTGGAG/ZEN/ TCCTTCTGCGAGGA/3IABkFQ/. Amplifications were carried out on a BioRad CFX96 Touch Thermocycler according to the following cycling parameters: 2 min at 95 °C followed by 44 cycles of 10 s at 95 °C and 30 s at 60 °C.
Zicari S., Arakelyan A., Palomino R.A., Fitzgerald W., Vanpouille C., Lebedeva A., Schmitt A., Bomsel M., Britt W, & Margolis L. (2018). Human cytomegalovirus-infected cells release extracellular vesicles that carry viral surface proteins. Virology, 524, 97-105.
+ Open protocol
+ Expand
2

Quantifying Viral DNA in EV Fractions

Check if the same lab product or an alternative is used in the 5 most similar protocols
200 μl aliquots of EV fraction, intermediate fraction, and HCMV fraction were subjected to nucleic acid extraction using a NucliSENS easyMAG 2.0 instrument (BioMérieux, Durham, NC). Quantitative real-time PCR (qPCR) was performed with a PerfeCTa FastMix II Low ROX kit (Quanta BioSciences, Gaithersburg, MD) using the following primer set: HHV-5 FWD: AACCAAGATGCAGGTGATAGG, HHV-5 REV: AGCG TGACGTGCATAAAGA, and the probe: /56-FAM/TACCTGGAG/ZEN/ TCCTTCTGCGAGGA/3IABkFQ/. Amplifications were carried out on a BioRad CFX96 Touch Thermocycler according to the following cycling parameters: 2 min at 95 °C followed by 44 cycles of 10 s at 95 °C and 30 s at 60 °C.
Zicari S., Arakelyan A., Palomino R.A., Fitzgerald W., Vanpouille C., Lebedeva A., Schmitt A., Bomsel M., Britt W, & Margolis L. (2018). Human cytomegalovirus-infected cells release extracellular vesicles that carry viral surface proteins. Virology, 524, 97-105.
+ Open protocol
+ Expand
3

DENV Detection in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 200 μl aliquot of the MNPs complexes with DENV produced in BHK-21 and LoVo cells and flow through fractions were subjected to nucleic acid extraction using a NucliSENS easyMAG 2.0 instrument (BioMérieux, Durham, NC). RT-PCR was performed with a qScript One-Step Fast MGB qRT-PCR kit (Quanta BioSciences, Gaithersburg, MD) using a one-step assay with the following primer set: DENV 2 NGC (forward): TATGCTGAAACGCGAGAGAAA, DENV 2 NGC (reverse): CTGCAGCATTCCAAGTGAGA, and the probe: FAM- CCG CGT GTC GAC TG TAC AAC AGC -MGB. Amplifications were carried out on a BioRad CFX96 Touch Thermocycler according to the following cycling parameters: 7.5 minutes at 48°C, 30 seconds at 95°C, followed by 45 cycles of 3 seconds at 95°C and 25 seconds at 60°C.
Zicari S., Arakelyan A., Fitzgerald W., Zaitseva E., Chernomordik L.V., Margolis L, & Grivel J.C. (2015). EVALUATION OF THE MATURATION OF INDIVIDUAL DENGUE VIRIONS WITH FLOW VIROMETRY. Virology, 488, 20-27.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!