The quantitative real-time RT-PCR was carried out for the selected genes using gene specific primers from Quantitect primer assay kit (Qiagen, Germany). QuantiFast one step RT-PCR kit was used for real time PCR and RNA polymerase-II (RP-II) was used as an endogenous reference gene. Briefly, the reaction mixture consisted of 12.5 μl of 2 × QuantiFast SYBR Green RT-PCR Master Mix, 2.5 μl 10 × Quantitect primer mix, 0.25 μl of Quantifast RT Mix, 100 ng (2 μl) of template RNA and 8.75 μl nuclease free water in 25 μl reaction volume. The Roche Light cycler-480 system was used to monitor the SYBR Green signal at the end of each extension period for 40 cycles. The thermal profile consisted of 10 min of reverse transcription at 50°C for one cycle and 5 min of polymerase activation at 95°C, followed by 40 cycles of PCR at 95°C for 10 s, 60°C for 30 s for combined annealing/extension. The relative quantification levels in expression were determined using the 2nd derivative maximum analysis with the determination of the crossing points for each transcript. Crossing point values for each target gene were normalized to the respective crossing point values for the reference gene RP-II. Data are presented as normalized ratios of genes along with standard error using Roche Applied Science E-Method [44 ].
E method
Manufactured by Roche
The E-Method is a laboratory equipment product designed for precise and efficient data analysis. It provides a reliable platform for data processing and interpretation. The core function of the E-Method is to facilitate the analysis of experimental results, enabling researchers to draw accurate conclusions from their work.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480 system, by Roche (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Quantitect primer assay kit, by Qiagen (1 mentions)
Cdna pre amp master, by Roche (1 mentions)
Light cycler 480 sybr green technology, by Roche (1 mentions)
Primescript rt reagent, by Takara Bio (1 mentions)
Rneasy plus micro kit, by Qiagen (1 mentions)
Nanodrop, by Avantor (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Probefinder software, by Roche (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Lightcycler 480 instrument 2, by Roche (1 mentions)
Mono color hydrolysis upl probes, by Roche (1 mentions)
6 protocols using e method
1
Quantitative Real-time RT-PCR Protocol
2
Pancreatic Alpha-cell and Intestinal L-cell mRNA Profiling
3
Quantitative Reverse Transcriptase Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The quantitative reverse transcriptase real-time PCR (qRT-PCR) was performed with the LightCycler480 using LightCycler480 Probes Master and Universal Probe Library (UPL) Set for Human (Roche). Primers with probes were designed by the Universal Probe Library Assay Design Center (https://qpcr.probefinder.com/organism.jsp ). Primers sequences are given in Table 1 . The efficiency of primers was estimated on the standard curve with series of 2-fold dilutions. The qRT-PCR proceeded under the following conditions: an initial 5 min preincubation at 95°C, 45 cycles of denaturation in 95°C for 10 sec, annealing at 55°C for 30 sec and extension at 72°C for 10 sec. Hypoxanthine phosphoribosyltransferase (HPRT) was used as the endogenous control. The LightCycler480 Software release 1.5.1.62 allowed for an analysis basing on the E-method (Roche) expression level. All experiments were performed in triplicates.
4
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the analysis of mRNA levels, relative quantification of target gene expression was performed using the Roche Applied Science E-Method. For ontogenesis and postprandial experiments, the target gene was normalized with exogenous luciferase transcript abundance (Promega). For nutritional experiments, the target gene was normalized with elongation factor 1α (EF1α) measured RNA. As the relative expression of luciferase control and EF1α did not significantly change over the sampling process (data not shown), in all cases, PCR efficiency was measured from the slope of a standard curve using serial dilutions of cDNA; PCR efficiency values ranged between 1.8 and 2.0.
5
Quantitative Analysis of ADAM10 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression level of ADAM10 was measured by quantitative real-time PCR and normalized to the mRNA expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). RNA was extracted using RNeasy Kit (Qiagen, Hilden, Germany) and quantified photometrically (NanoDrop, Peqlab, Erlangen, Germany). 300 µg RNA was reverse transcribed using PrimeScript™ RT Reagent Kit (Takara Bio Europe, St-Germain-en-Laye, France) and PCR reactions were performed using SYBR Premix Ex Taq II (Takara Bio Europe) according to the manufacturer's protocol. The following primers were used: ADAM10 forward, ggattgtggctcattggtgggca; ADAM10 reverse, actctctcggggccgctgac; GAPDH forward, ccagccccagcgtcaaaggtg; GAPDH reverse, cggggctctccagaacatcatcc. All PCR reactions were run on a LightCycler 480 System (Roche, Basel, Schweiz) with 45 cycles of 10 s denaturation at 95 °C, followed by 30 s annealing at 61 °C (ADAM10), or 66 °C (GAPDH) and 15 s amplification at 72 °C. Standard curves were determined using a serially diluted internal standard. Relative quantification was performed with the E-Method from Roche Applied Bioscience using the LightCycler®480 software 1.5.
6
Comprehensive Antioxidant Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (0.5 µg) was used for cDNA synthesis with the Transcriptor First-Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) using oligo (dT) primers following the manufacturer’s description. Real-time PCR analysis was performed to determine the expression levels of the SOD, CAT, GSS, SESN1, SESN2, NRF2, NFKB, SIRT2, PGC1, PARP, TFA, and p53 genes. Each cDNA sample was analyzed using Mono Color Hydrolysis UPL Probes (Roche, Basel, Switzerland) selected for each gene by using ProbeFinder Software (Roche, Basil, Switzerland). The PCR reaction mixtures were prepared in line with the manufacturer’s protocol. PCR conditions for all genes were as follows: initial incubation step at 94 °C for 10 min, followed by 45 cycles of amplification (15 s at 94 °C, 30 s at 60 °C, and 15 s at 72 °C) (single acquisition), with a final cooling step at 40°C for 2 min. The analysis was performed using a LightCycler 480 II instrument (Roche, Basel, Switzerland). Relative gene expression was calculated using the Roche Applied Science E-Method and normalized to the reference genes ACT, TBP, PGK1, and HPRT1. All standard curves were generated by amplifying a series of twofold dilutions of cDNA. The primer sequences for the analyzed genes and UPL probes are shown in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!