Lenticrispr v2

Manufactured by New England Biolabs

Sourced in United States

LentiCRISPR v2 is a lentiviral CRISPR/Cas9 system developed by New England Biolabs. It is designed for the delivery of the Cas9 enzyme and guide RNA into target cells for gene editing applications.

Automatically generated - may contain errors

Lab products found in correlation

Lenticrispr v2, by Addgene (4 mentions) T4 ligation buffer, by New England Biolabs (3 mentions) T4 pnk, by New England Biolabs (3 mentions) Quick ligase, by New England Biolabs (2 mentions) T4 dna ligase, by New England Biolabs (2 mentions) Bsmb1, by New England Biolabs (1 mentions) Lenticrispr v2 vector, by Addgene (1 mentions) Polybrene, by Thermo Fisher Scientific (1 mentions) Pes filter, by Merck Group (1 mentions) Quick ligase buffer, by New England Biolabs (1 mentions) Lenticrispr v2 plasmid, by Addgene (1 mentions) Fastap, by Thermo Fisher Scientific (1 mentions) Esp3i restriction enzyme, by Thermo Fisher Scientific (1 mentions) Stbl3 chemically competent e coli, by Thermo Fisher Scientific (1 mentions) Qiaquick gel extraction kit, by Qiagen (1 mentions) Qiaprep spin miniprep kit, by Qiagen (1 mentions) Bsmbi v2, by New England Biolabs (1 mentions)

6 protocols using lenticrispr v2

CRISPR-Cas9 Targeting of Human CDKN2A Locus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eight 20-nt DNA sequences (see below) in exons 1 and 2 in the human genomic CDKN2A locus were selected for producing single-guide RNA for CRISPR-associated DNA endonuclease targets by using a publically available resource (http://crispr.mit.edu). The lentiCRISPR v2 vector^{35 (link)} was purchased from Addgene (Cat. #52961). The oligos were annealed with bottom oligos and cloned into lentiCRISPR v2 restricted by BsmB1 (#R0580S; New England Biolabs, Boston, MA, USA). All generated constructs were analyzed by DNA sequencing using a primer specific to the U6 promoter.

Sequence	Target site
5′-CACCGACCGTAACTATTCGGTGCGT-3′	Exon 1
5′-CACCGGGCCTCCGACCGTAACTATT-3′	Exon 1
5′-CACCGCACCGAATAGTTACGGTCGG-3′	Exon 1
5′-CACCGACGCACCGAATAGTTACGGT-3′	Exon 1
5′-CACCGGGTACCGTGCGACATCGCGA-3′	Exon 2
5′-CACCGACCTTCCGCGGCATCTATGC-3′	Exon 2
5′-CACCGTGGGCCATCGCGATGTCGCA-3′	Exon 2
5′-CACCGGCCCGCATAGATGCCGCGGA-3′	Exon 2

Herling C.D., Abedpour N., Weiss J., Schmitt A., Jachimowicz R.D., Merkel O., Cartolano M., Oberbeck S., Mayer P., Berg V., Thomalla D., Kutsch N., Stiefelhagen M., Cramer P., Wendtner C.M., Persigehl T., Saleh A., Altmüller J., Nürnberg P., Pallasch C., Achter V., Lang U., Eichhorst B., Castiglione R., Schäfer S.C., Büttner R., Kreuzer K.A., Reinhardt H.C., Hallek M., Frenzel L.P, & Peifer M. (2018). Clonal dynamics towards the development of venetoclax resistance in chronic lymphocytic leukemia. Nature Communications, 9, 727.

+ Open protocol

+ Expand

CRISPR Knockout of G6PD in MDA-MB 231SCP:28TR Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Generation of batch G6PD-null cells for mammary fat pad and tail-vein injection assays in the MDA-MB 231SCP:28TR background was achieved using the lentiviral CRISPR–Cas9 vector system lentiCRISPR v2 (Addgene #52961). Briefly, sgRNA sequences targeting exon-5 of human G6PD were designed using the crispr.mit.edu design tool. The identified PAM sequences or scrambled control sequence (Supplementary Table 1) were subcloned into the lentiCRISPR v2 using the BsmBI restriction endonuclease (NEB R0580S). Virus was produced through PEI (MilliporeSigma, 408727) transfection of vectors and lentiviral packaging plasmids psPax2 and VSVG in 293T cells. Medium containing lentivirus was collected after two days and filtered through a PES filter (0.22 μm, MilliporeSigma). Cells were transfected with virus containing scrambled control or targeting G6PD and Polybrene (8 ug/mL, Invitrogen). Cells were split after 48 h into RPMI-media (10% FBS) containing puromycin (2 ug/mL) and cultured for 3 days. Cells were passaged once more in puromycin media prior to utilization in xenograft experiments. G6PD knockout was confirmed by western blotting.

Ghergurovich J.M., Esposito M., Chen Z., Wang J.Z., Bhatt V., Lan T., White E., Kang Y., Guo J.Y, & Rabinowitz J.D. (2020). Glucose-6-phosphate dehydrogenase is not essential for K-Ras-driven tumor growth or metastasis. Cancer research, 80(18), 3820-3829.

+ Open protocol

+ Expand

Lentiviral CRISPR Plasmid Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiCRISPR v2 plasmid was purchased from Addgene (Addgene #52961). 500ng LentiCRISPR v2 plasmid is linearized with BsmBI (NEB) at 55°C for 4 hours and purified with 1% agarose gel. The sgRNA sequences are listed in Table S3. For one sgRNA, we designed two oligos complementary to each other in the following format: 5′-CACCGXXXXXXXXXXXXXXXXXXXX-3′ and 5′-AAACYYYYYYYYYYYYYYYYYYYYC-3′ (X 20-mers and Y 20-mers are complementary target sequences). To anneal the complimentary oligos, 1uL from each of the two oligos (100 uM), 1uL 10x T4 ligation buffer (NEB), 6.5uL H2O and 0.5uL T4 PNK (NEB) were mixed together and incubated at 37°C for 30 minutes followed by incubation in 95°C for 5 minutes. After 95°C incubation, shut off the block heater and let the reaction cooled down naturally to room temperature. Annealed oligos were then diluted at 1:200 dilution for use. To clone the individual sgRNAs, 50ng linearized vector, 1uL diluted oligo complex, 5uL 2X quick ligase buffer (NEB) are mixed and add water to 9uL. 1uL quick ligase (NEB) were next added into the mixture and the reaction is performed at 25°C for 10 minutes. 5uL ligation products were transformed immediately into Stbl3 bacteria following standard transformation protocol.

Fang Z., Weng C., Li H., Tao R., Mai W., Liu X., Lu L., Lai S., Duan Q., Alvarez C., Arvan P., Wynshaw-Boris A., Li Y., Pei Y., Jin F, & Li Y. (2019). Single-Cell Heterogeneity Analysis and CRISPR Screen Identify Key β-Cell-Specific Disease Genes. Cell reports, 26(11), 3132-3144.e7.

+ Open protocol

+ Expand

Lentiviral CRISPR library construction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiCRISPRv2 (Addgene, cat. No. 52961) was digested using the Esp3I restriction enzyme (ThermoFisher, cat. No. ER0451, Toronto, ON, Canada), dephosphorylated using FastAP (ThermoFisher, cat. No. EF0654), agarose gel purified and extracted using a QIAquick Gel Extraction Kit (QIAGEN, cat. No. 28704, Germantown, MD, USA). Each single-guide primer sequences shown in Table 1 (5′-3′) was phosphorylated using T4 PNK (NEB, cat. No. M0201S, Beverly, MA, USA), annealed by slow cooling from 65 °C to room temperature in T4 ligation buffer (NEB, cat. No. B0202S) and ligated in Esp3I-digested LentiCRISPRv2 purified plasmid using Quick Ligase (NEB, cat. No. M2200S). Each sgRNA ligated plasmid was transformed in STBL3 chemically competent E. coli (ThermoFisher, cat. No. A10469) and collected from an amplified single bacterial colony using a QIAprep Spin Miniprep Kit (QIAGEN, cat. No. 27104) [31 (link),32 (link)].
Each sgRNA was designed with ChopChop [33 (link)]. The chromosomal positioning of the sgRNA binding site as well as off-target and on-target activity evaluation was performed with CRISPOR [34 (link)] (Supplementary Table S1).

Boudreault J., Wang N., Ghozlan M, & Lebrun J.J. (2024). Transforming Growth Factor-β/Smad Signaling Inhibits Melanoma Cancer Stem Cell Self-Renewal, Tumor Formation and Metastasis. Cancers, 16(1), 224.

+ Open protocol

+ Expand

Lentiviral Cas9 Expression and sgRNA Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the Cas9-expressing THP-1 cells or iPSC lines in this study were derived by lentiviral transduction with a Cas9 expression vector containing an optimized sgRNA backbone (LentiCRISPR v2; Addgene, 52961). All of the sgRNAs were cloned into the LentiCRISPR v2 vector following the protocol described before^{41 (link)}. And the sgRNAs used in this study were shown in Supplementary Table 1. The annealed sgRNA oligonucleotides were ligated with T4 DNA ligase (M0569S, NEB) to the BsmB1-digested LentiCRISPR v2 vector.

Wang X., Su S., Zhu Y., Cheng X., Cheng C., Chen L., Lei A., Zhang L., Xu Y., Ye D., Zhang Y., Li W, & Zhang J. (2023). Metabolic Reprogramming via ACOD1 depletion enhances function of human induced pluripotent stem cell-derived CAR-macrophages in solid tumors. Nature Communications, 14, 5778.

+ Open protocol

+ Expand

CRISPR Lentiviral Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Oligonucleotides (Yale, Keck Oligo) were generated with BsmBI-compatible overhangs (guide 1 pair: CACCGTCAGCAACCTCTAACTAACC, AAACGGTTAGTTAGAGGTTGCTGAC; guide 2 pair: CACCGTGAGAAACACCAATTTCCGA, AAACTCGGAAATTGGTGTTTCTCAC). Oligos were annealed and phosphorylated using equimolar ratios of oligo pairs with 1× T4 Ligation Buffer (New England Biolabs) and T4 PNK (New England Biolabs) at 37°C for 30 minutes, 95°C for 5 minutes, then −5°C/minute to 25°C. LentiCRISPRv2 (Addgene #52961) was digested by BsmBI-v2 (New England Biolabs) for 2 hours at 55°C in 1× NEBuffer 3.1. Double-stranded oligonucleotides were ligated into the digested LentiCRISPRv2 vector using T4 DNA ligase (New England Biolabs) according to manufacturer’s protocol. Ligated vectors were transformed into Stbl3 cells and sequence verified for correct guide insertion. Lentiviral plasmids were cotransfected with packaging plasmids pSPAX2 and pVSV-G in HEK293T cells, and Calu-3 cells were transduced with lentiviral particles. Transduced cells were selected with puromycin for 2 weeks prior to infection.

Strine M.S., Cai W.L., Wei J., Alfajaro M.M., Filler R.B., Biering S.B., Sarnik S., Chow R.D., Patil A., Cervantes K.S., Collings C.K., DeWeirdt P.C., Hanna R.E., Schofield K., Hulme C., Konermann S., Doench J.G., Hsu P.D., Kadoch C., Yan Q, & Wilen C.B. (2023). DYRK1A promotes viral entry of highly pathogenic human coronaviruses in a kinase-independent manner. PLOS Biology, 21(6), e3002097.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!