Mir 34b mirna mimics

A fragment of the Cp110 mRNA 3′UTR containing two predicted miR-34/449 sites was cloned into the FseI site immediately downstream of the stop codon in the pGL3-Control firefly luciferase vector (Promega, #E1741). We amplified a fragment of Cp110 3UTR using PCR with Cp110-3′UTR-F, AAGGCCGGCCGAAGACAGCACTCACTGGGA, and Cp110-3′UTR-R, GTGGCCGGCCTTCTCTGAGATCCGGATTGC. NIH/3T3 cells were cultured in 10% bovine serum in DMEM (Invitrogen, # 11995-073) in a 12-well plate at a density of 1 × 10⁵ cells/well. We co-transfected each well of NIH3T3 cells with 10 ng of pGL3 constructs, 100 ng of pRL-TK Renilla vector (Promega, #E2241), and 15 nM miR-34b miRNA mimics (Integrated DNA Technologies, 5′ AGGCAGUGUAAUUAGCUGAUUGU 3′ and 5′ AAUCACUAACUCCACUGUUAUC 3′) or siGFP (Integrated DNA Technologies) using TransIT-TKO Transfection Reagent (Mirus Bio, #MIR 2150). At 24 hours after transfection, firefly and Renilla luciferase activities were measured using the Dual-Luciferase reporter assay system (Promega, #E1910). The luciferase activity was normalized as the ratio of firefly/Renilla luciferase activities.