Lc480 qpcr system

Manufactured by Roche

Sourced in Germany

The LightCycler® 480 System is a real-time PCR instrument designed for the detection and quantification of nucleic acids. It features a thermal cycler and optical detection system for performing real-time PCR experiments. The system can analyze up to 384 samples simultaneously and supports a wide range of applications, including gene expression analysis, genotyping, and pathogen detection.

Automatically generated - may contain errors

Lab products found in correlation

Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions) Tb green premix ex taq 2 reagent, by Takara Bio (1 mentions) Truseq stranded mrna sample preparation kit, by Illumina (1 mentions) Nextseq sequencer, by Illumina (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Oligo dt, by Promega (1 mentions) Sybr green mix, by Roche (1 mentions) M mlv enzyme, by Promega (1 mentions)

Close spelling variants of this product

LC480 (158 citations) LC480 system (31 citations)

3 protocols using lc480 qpcr system

Sensitive qPCR Quantification of snoRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 3 μg isolated RNA was reverse-transcribed into complementary DNA (cDNA) using Mir-X miRNA First-Strand Synthesis Kit (TaKaRa Bio, Nojihigashi, Kusatsu, Japan) in 10 μl reaction according to the manufacturer's instructions. Furthermore, qPCR was conducted by TB Green Premix Ex Taq II Reagent (TakaRa Bio, Nojihigashi, Kusatsu, Japan) in a volume of 20 μl (10 μl of TB Green Premix Ex Taq II Reagent, 0.4 μl of forward primer, 0.4 μl of reverse primer, 2 μl cDNA and 7.2 μl water) at the LC480 qPCR system (Roche Diagnostics, BALE, Germany). The reactions started at 95 °C for 30 s, followed by 45 cycles of 95 °C for 5 s and 60 °C 30 s; then ended at 50 °C 5 s and 60 °C for 1 min. All experiments were carried out in duplicate, and then the median Ct was calculated, U6 was used as an internal control. The relative expression of snoRNAs was evaluated by the comparative cycle threshold (ΔCt) method: (ΔCt = Ct^snoRNA–Ct^U6) as described previously [12 (link)]. The qPCR primers were listed in Table 1 and Additional file 1: Table S1.Table 1

Primers sequence involved

Gene	Forward primer	Reverse primer
SNORD63	GTGCAATGATGTATTTTATTCAACACA	GCTCAGTCATTAGTTTTCCACACG
SNORD96A	CCTGGTGATGACAGATGGCA	CCTTCAGAATTGCAGGACATGT
U6	TGGAACGCTTCACGAATTTGCG	GGAACGATACAGAGAAGATTAGC

Shang X., Song X., Wang K., Yu M., Ding S., Dong X., Xie L, & Song X. (2021). SNORD63 and SNORD96A as the non-invasive diagnostic biomarkers for clear cell renal cell carcinoma. Cancer Cell International, 21, 56.

+ Open protocol

+ Expand

Illumina RNA-seq Protocol for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA 200 ng from each cell line sample was prepared for sequencing using Illumina TruSeq Stranded mRNA Sample Preparation Kit. Fifteen-cycle-PCR was performed, and the libraries were quantified using the LC480 qPCR system (Roche). Then, all libraries were pooled into a new 1.5 mL tube as a 10 nM pooled DNA library. The final pool was used for sequencing (illumina NextSeq sequencer, 2 × 150 bp). The raw output file of each individual library was > 3GB. The sequence of each read was trimmed based on the quality score (Q30), and read lengths less than 45 bp were discarded prior to further analysis [56 (link)]. Finally, reads were aligned to the human hg19 reference genome using STAR aligner [57 (link)] for subsequent comparison and analysis. The datasets are available at Gene Expression Omnibus, data series GSE179787.

Wu C.E., Huang C.Y., Chen C.P., Pan Y.R., Chang J.W., Chen J.S., Yeh C.N, & Lunec J. (2021). WIP1 Inhibition by GSK2830371 Potentiates HDM201 through Enhanced p53 Phosphorylation and Activation in Liver Adenocarcinoma Cells. Cancers, 13(15), 3876.

+ Open protocol

+ Expand

Quantifying mRNA Expression by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by using the RNeasy mini kit (QIAGEN). 2 µg RNA was retrotranscribed using M-MLV enzyme and oligodT (Promega). qPCR was then performed using SYBR Green Mix (Roche) with the LC480 qPCR system (Roche). The following oligos primers were used: ULK1, 5′-CAGACAGCCTGATGTGCAGT-3′; 5′-CAGGGTGGGGATGGAGAT-3′; β-ACTIN: 5′-CCAACCGCGAGAAGATGA-3′; 5′-CCAGAGGCGTACAGGGATAG-3′; NEDD4L: 5′-AGCCCAATGGGTCAGAAATAA-3′; 5′-TCTGGACCCTGTTCACAAATC-3′. Melting curve analysis was used to confirm primer specificity. To ensure linearity of the standard curve, reaction efficiencies over the appropriate dynamic range were calculated. Using the ddCt method, we calculated fold-increases in the mRNA expression of the gene of interest normalized to β-Actin expression. We then normalized the mRNA levels to the control condition. Reported values are the means of three independent biological replicates with technical triplicates that were averaged for each experiment. Error bars represent SD of the mean.

Nazio F., Carinci M., Valacca C., Bielli P., Strappazzon F., Antonioli M., Ciccosanti F., Rodolfo C., Campello S., Fimia G.M., Sette C., Bonaldo P, & Cecconi F. (2016). Fine-tuning of ULK1 mRNA and protein levels is required for autophagy oscillation. The Journal of Cell Biology, 215(6), 841-856.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!