Alexafluor 488

Cells in a 12-well plate were incubated with nucleolin aptamer or mutant aptamer at 100 nM for 3 h (37°C, 5% CO₂) then treated with DNase for 10 minutes to degrade any non-internalized aptamer. Cells were washed with PBS and trypsinized with 0.05% Trypsin for FACs analysis (Becton Dickinson FACSCalibur flow cytometer). The aptamers were conjugated at the 5′ end with Alexafluor 488 (Integrated DNA Technologies, Coralville, IA 52241).

The effect of caffeine on the binding of yeast Rad51 or Rad52 to ssDNA was assayed by the fluorescence polarization method as described previously (49 (link)) with the following modifications. An 84-mer ssDNA conjugated with Alexa Fluor-488 at the 5′ (sequence: 5′GGTAGCGGTTGGGTGAGTGGTGGGGAGGGTCGGGAGGTGGCGTAGAAACATGATAGGAATGTGAATGAATGAAGTACAAGTAAA-3′; synthesized by Integrated DNA Technologies) was used at 200 nM nucleotides (2.4 nM molecule). The binding reactions were performed at 37°C for 30 min in buffer B (25 mM Tris-HCl (pH 7.8); 5 mM MgCl₂, 3 mM ATP, 1 mM DTT, 20 mM NaCl₂, 50 μM CaCl₂ and 100 μg/ml bovine serum albumin (BSA)). The fluorescence polarization (in mP units) was measured using a Tecan Infinite F200 PRO plate reader. All binding conditions were performed in triplicate, and the mean values plotted with standard deviation. Caffeine had no effect on fluorescence polarization in the absence of added protein (data not shown). The methods used to purify the ScRad51 and ScRad52 protein were described previously (25 (link)).

DNA oligonucleotides labeled with AlexaFluor 488® were obtained from Integrated DNA Technologies (Coralville, IA). The concentration of each oligonucleotide was determined by measuring its absorbance at 260 nm, using the extinction coefficients provided by the manufacturer. RNase A (endonuclease-free) was purchased from Qiagen Inc. (Germantown, MD). Escherichia coli uracil DNA glycosylase (UDG) was obtained from New England Biolabs (Beverly, MA). Gel loading buffer and nuclease-free water were purchased from Ambion® (Life Technologies, Grand Island, NY). Anti-A3H sera (p3A3 or p1H6), anti-HIV-1 CA sera (for ERT experiments), and TZM-bl cells (from John C. Kappes, Xiaoyun Wu, and Tranzyme Inc.) [102 (link)-104 (link)] were obtained from the AIDS Research and Reference Reagent Program (Division of AIDS, NIAID, NIH). An anti-HIV-1 p24 monoclonal antibody was purchased from ZeptoMetrix (Franklin, MA) and was used for detection of CA and Pr55^gag in virions and cell lysates, respectively (see Figure 5). A monoclonal antibody (Anti-FLAG M2) against a FLAG tag was obtained from Sigma-Aldrich (St. Louis, MO). Anti-tubulin antibody was purchased from Abcam (Cambridge, MA).