Calf intestinal alkaline phosphatase

REMI was performed essentially as previously described^{37 (link)}. To generate vectors bearing restriction-enzyme sites at DNA ends, the plasmid pHygTm(plus)/pG7 (containing a Hygromycin cassette) was cut with BamH1 (NEB), treated with calf intestinal alkaline phosphatase (NEB) and purified on PCR clean up columns (QIAGEN^®). 4.5 × 10⁶ cells per condition were transfected with 2 µg of BamH1-linearised construct with or without 20 units of the restriction-enzyme BamH1 (NEB). Electroporated cells were spread on four 140 mm plates with axenic HL5 media. 24 h after transfection, hygromycin (35 μg/ml) was added for 5 days. Afterwards, plates were washed with KK2, fixed with 3.7% formaldehyde and stained with Crystal Violet solution. Colonies were counted and REMI induction calculated as the ratio of colony numbers with and without BamH1. Graphs of data were constructed using Excel 2016.

For the generation of transgenic mice, sequences encoding WT PrP and mutant S1 and S3.F88W PrP were inserted into the MoPrP.Xho ‘half-genomic’ vector (Borchelt et al, 1996 (link); Fischer et al, 1996 (link)). Mutant PrP sequences were extracted from the mutant PrP plasmids described above using the primers 5′AAAAACTCGAGGCCCTCATCCCACGATCAGG3′ and 5′AAAAACTCGAGAGTCCAATTTAGGAGAGCCAAG3′, which contain XhoI restriction enzyme sites. Polymerase chain reaction (PCR) fragments were cloned into pCR2.1.TOPO (Invitrogen), and sequences were verified. DNA from TOPO clones was digested using XhoI (New England Biolabs), isolated by gel electrophoresis and purified with a gel extraction kit (Qiagen). The MoPrP.Xho vector was digested with XhoI, treated with calf intestinal alkaline phosphatase (New England Biolabs), phenol:chloroform-extracted and ethanol-precipitated or purified with the Ultraclean Gel Spin DNA Purification Kit (MoBio Laboratories). After ligation of digested fragments, the sequenced DNA was amplified and purified using the Endo-Free Maxiprep Kit (Qiagen). To prepare for injection, the DNA was digested with NotI and purified using the gel extraction kit (Qiagen) or Ultraclean Gel Spin DNA Purification Kit (MoBio Laboratories). The DNA was then injected into the pronuclei of mouse FVB embryos by the University of Calgary Transgenic Services.