Multiplex master mix

Mutation validation was performed with bidirectional sequencing of the selected sample sites. PCR reactions were prepared using 5 ng of genomic DNA, 0.4 µM oligonucleotide primers, and 0.7X Qiagen Multiplex Master Mix (Cat. no. 206145) containing HotStar Taq, buffer, and polymerase. Reactions were performed with and without QSOL PCR additive to enhance PCR and final sequence performance. Touchdown PCR was performed with the following parameters: 98°C for 5 min. and 10 cycles of 98°C for 30 sec., 72°C for 30 sec. (decreasing by 1°C per cycle), and 72°C for 1 min. The reaction then continued with 30 cycles of 98°C for 30 sec., 63°C for 30 sec., and 72°C for 1 min, followed by a final extension at 72°C for 5 min. The PCR products were purified with a 1:15 dilution of Exo-SAP, diluted by 0.6X, and then cycle-sequenced for 25 cycles using a 1/64^th dilution of BigDye Terminator v3.1 reaction mix (Applied Biosystems, Cat. No. 4337456). Finally, reactions were precipitated with ethanol, resuspended in 0.1 mM EDTA, and analyzed on AB 3730xl sequencing instruments using the Rapid36 run module and 3xx base-caller. SNPs were identified using SNP Detector software and then visually validated with Consed.

CSF specimens with volumes ranged from 200 to 400 µL were stored at −20 °C. After thawing the CSF samples, they were centrifuged for 15 min at 13,000 ×g and the supernatant was removed. Four hundred microliters of distilled water was added, and the pellet was resuspended. And then, pathogen genomic DNA was extracted by using E.Z.N.A. MicroElute Genomic DNA Kit (Omega, Doraville, GA, USA), according to the manufacturer’s instructions. DNA was eluted in 30 µL elution buffer and was subsequently stored at –20 °C, and thawed once just before use. The multiplex PCR amplification was performed in a total volume of 25 µL containing the following: 1 × multiplex master mix (Qiagen, Ballerup, Denmark), 8 μL genomic DNA template and 200 nM of each primer (Takara, Dalian, Liaoning, China) (Table 1), Positive control just needed 1 μL (80–130 ng) plasmid DNA and distilled water was used as a negative control. Amplification conditions were as follows: 95 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 59 °C for 90 s, and 72 °C for 30 s, and a final extension step of 72 °C for 10 min, and stored at 4 °C.

Genetic analysis was done at the Norwegian Institute for Nature Research (NINA). DNA was extracted from the whole animal for juveniles and from cotton swabs for adults using DNeasy tissue kits (Qiagen). Mussels were genotyped at 15 microsatellite loci: MarMa3050, MarMa3621, MarMa4277, MarMa4322, MarMa2671, MarMa4143 and MarMa5280 (Geist et al. 2003 (link)) and Mm2201, Mm2230, Mm2235, Mm2240, Mm2207, Mm2210 and Mm2233, Mm2236 (Garlie 2010 ). PCR was carried out in two multiplexes (Karlsson et al. 2016 ). The following PCR protocol was used: 2-μl DNA, 4-μl Qiagen Multiplex Mastermix, 0.8-μl Primermix and 1.6-μl RNase-free water (Karlsson et al. 2016 ). The PCR was run on a Quattro Cycler (VWR) in the following conditions: denaturation for 15 min at 95 °C, followed by 30 cycles of 57 °C for 90 s and 72 °C for 60 s, and a final step of 60 °C for 30 min (Karlsson et al. 2016 ). For each multiplex, PCR products were visualised separately on an ABI 3130xl DNA analyser (Applied Biosystems) and sized using GENEMAPPER ver. 3.7 (Applied Biosystems).

Repeat primed–PCR was used to confirm the presence or absence of the C9ORF72 hexanucleotide repeat expansion in control or carrier neurons. PCR amplification was carried out using Multiplex Mastermix (Qiagen); 7% dimethylsulfoxide, 0.6 M Betaine, 7.6 μM Primer F (5′- CTGTAGCAAGCTCTGGAACTCAGGAGTCG -3′), 3.6 μm Primer Repeat R (5′- TACGCATCCCAGTTTGAGACGCCCCGGCCCCGGCCCCGGCCCC -3′), 11.6 μM Tail R (5′- TACGCATCCCAGTTTGAGACG -3′), 8 μM 7-deaza-2′-dGTP and 200 ng DNA. Cycling conditions were performed as per the manufacturer’s recommendations, except for the annealing temperature, which was 68 °C for 15 cycles, then 60 °C for a further 20 cycles. PCR products were separated on an ABI 3130 × l analyser (Life Technologies) and data were analysed using GeneMarker software (Soft Genetics).

For individual identification from the confirmed dhole scats, we used the earlier validated 12 microsatellite loci panel described in Modi et al.^{26 (link)} (Supplementary Table 1). We performed PCR reactions in 10 μl reaction volumes containing 4 μl of Multiplex master mix (QIAGEN Inc., Hilden, Germany), 4 μM (2.5 μl) BSA, 0.5 μM of primer mix and 3 μl of DNA extract with PCR conditions including initial denaturation (95 °C for 15 min); 50 cycles of denaturation (94 °C for 30 s), annealing (50 °C for 30 s) and extension (72 °C for 35 s); followed by a final extension (72 °C for 10 min)^{26 (link)}. Negative and extraction controls were included to monitor contaminations. Amplified products were mixed with HiDi formamide and LIZ 500 size standard (Applied Biosystems, California, United States) and genotyped in an ABI genetic analyzer (Applied Biosystems, California, United States). We scored the fragment lengths manually using the same reference sample and following stringent criteria described in Modi et al.^{26 (link)}. All samples were genotyped three independent times to ensure good data quality for subsequent analyses. We have also included 101 individual genotypes from our previous study^{26 (link)} collected from five protected areas (MTR, TATR, PTR, NNTR, UKWLS) along with the newly generated data for further analysis.

For juveniles, DNA was extracted from the whole animal and for adults from cotton swabs using dneasy tissue kits (Qiagen). The mussels were genotyped at 15 loci: MarMa3050, MarMa3621, MarMa4277, MarMa4322, MarMa2671, MarMa4143, MarMa5280 (Geist, Rottmann, Schröder, & Kühn, 2003), and Mm2201, Mm2230, Mm2235, Mm2240, Mm2207, Mm2210, Mm2233, Mm2236 (Garlie, 2010). PCR was carried out in two multiplexes (Karlsson, Larsen, Balstad, Eriksen, & Hagen, 2016). The PCR protocol was as follows: 2 μl DNA, 4 μl Qiagen multiplex mastermix, 0.8 μl primermix, and 1.6 μl RNase free water (Karlsson et al., 2016). The PCR was run on a Quattro Cycler (VWR) in the following conditions: denaturation for 15 min at 95°C, followed by 30 cycles of 57°C for 90 s and 72°C for 60 s, and a final step of 60°C for 30 min (Karlsson et al., 2016). The PCR products of each multiplex were visualized separately on an ABI 3130xl DNA analyzer (Applied Biosystems) and sized using GENEMAPPER ver. 3.7 (Applied Biosystems).