Log In Sign up
The largest database of trusted experimental protocols

Nucleocounter nc 200 cell counter

Manufactured by ChemoMetec
Visit Supplier
Sourced in Denmark

The NucleoCounter NC-200 Cell Counter is a compact and automated instrument used for counting and analyzing cells. It utilizes a fluorescence-based method to accurately determine the total cell count and cell viability. The NucleoCounter NC-200 provides reproducible and reliable results, making it a versatile tool for use in various cell-based applications.

Automatically generated - may contain errors

Lab products found in correlation

L glutamine, by Thermo Fisher Scientific (4 mentions) Anti clumping agent, by Thermo Fisher Scientific (3 mentions) Cho s cells, by Thermo Fisher Scientific (3 mentions) Freestyle max transfection reagent, by Thermo Fisher Scientific (3 mentions) Erlenmeyer shake flasks, by Corning (3 mentions) 6 well plate, by BD (3 mentions) Cho s suspension cells, by Thermo Fisher Scientific (2 mentions) Cd cho medium, by Thermo Fisher Scientific (2 mentions) Propidium iodide, by Thermo Fisher Scientific (1 mentions) 96 well optical bottom microplate, by Greiner (1 mentions) Hoechst 33342, by Thermo Fisher Scientific (1 mentions) Celigo cell imaging cytometer, by Revvity (1 mentions) Cho s, by Thermo Fisher Scientific (1 mentions) Cho k1, by American Type Culture Collection (1 mentions) Optipro sfm, by Thermo Fisher Scientific (1 mentions) Propidium iodide, by Carl Roth (1 mentions) Anti clumping reagent ac, by Thermo Fisher Scientific (1 mentions) Collagenase 4, by Thermo Fisher Scientific (1 mentions) Dmem f12 glutamax medium, by Thermo Fisher Scientific (1 mentions) β mercaptoethanol, by Thermo Fisher Scientific (1 mentions)

15 protocols using nucleocounter nc 200 cell counter

1

Culturing Suspension CHO-S Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO-S suspension cells (Life Technologies, Thermo Scientific, Rockford, IL) were grown as previously described (Grav et al., 2015 (link)). In summary, cells were grown in CD CHO medium supplemented with 8mM L-glutamine and 2 μL/mL anti-clumping agent (Life Technologies). Cells were expanded in Corning vent cap shake flasks (Sigma-Aldrich, St.Louis, MO) in a humidified incubator at 120 rpm (25 mm orbit), 37°C and 5% CO2. Viable cell densities were measured using the NucleoCounter NC-200 Cell Counter (ChemoMetec, Allerod, Denmark) and cells were passed into fresh medium every two to three days with seeding densities at 3–5×105 cells/mL.
Spahn P.N., Hansen A.H., Hansen H.G., Arnsdorf J., Kildegaard H.F, & Lewis N.E. (2015). A Markov chain model for N-linked protein glycosylation – towards a low-parameter tool for model-driven glycoengineering. Metabolic engineering, 33, 52-66.
+ Open protocol
+ Expand
2

CRISPR-Mediated Knockout of Bag6 and Zfx

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
One new gRNA for each gene was designed to target Bag6 and Zfx gene, respectively. The target sequences of gRNAs targeting Bag6, Zfx are GGCATTCCGGTCATGAACAGAGG (Bag6-gRNA) and TTCTTCTGAAACAACATCGGCGG (Zfx-gRNA), respectively. Detailed materials and methods for gRNA design and the gRNA vector construction are elaborated in our previous study (Xiong et al., 2019 (link)). The CHO-Cas9 cells with stable expression of Cas9 was transfected with gRNAs. 7 days after transfection, the recovered cells were cultured in the medium described as above with 20ng/mL tunicamycin (TM) for 4 days as indicated in legends. The CHO-Cas9 cells transfected with GFP or NT-gRNA were treated with 20ng/mL TM as control. The medium was never changed during these 4 days of TM treatment. The cell viability and the VCD were measured using the NucleoCounter NC-200 Cell Counter (ChemoMetec, Denmark) during this TM treatment process. A non-targeting gRNA was used as control as described previously (Karottki et al., 2020 (link)).
Xiong K., la Cour Karottki K.J., Hefzi H., Li S., Grav L.M., Li S., Spahn P., Lee J.S., Ventina I., Lee G.M., Lewis N.E., Kildegaard H.F, & Pedersen L.E. (2021). An optimized genome-wide, virus-free CRISPR screen for mammalian cells. Cell Reports Methods, 1(4), 100062.
+ Open protocol
+ Expand
3

Investigating Bag6 and Zfx Genes Using CRISPR

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
One new gRNA for each gene was designed to target Bag6 and Zfx gene, respectively. The target sequences of gRNAs targeting Bag6, Zfx are GGCATTCCGGTCATGAACAGAGG (Bag6-gRNA) and TTCTTCTGAAACAACATCGGCGG (Zfx-gRNA), respectively. Detailed materials and methods for gRNA design and the gRNA vector construction are elaborated in our previous study (Xiong et al., 2019 (link)). The CHO-Cas9 cells with stable expression of Cas9 was transfected with gRNAs. 7 days after transfection, the recovered cells were cultured in the medium described as above with 20ng/mL tunicamycin (TM) for 4 days as indicated in legends. The CHO-Cas9 cells transfected with GFP or NT-gRNA were treated with 20ng/mL TM as control. The medium was never changed during these 4 days of TM treatment. The cell viability and the VCD were measured using the NucleoCounter NC-200 Cell Counter (ChemoMetec, Denmark) during this TM treatment process. A non-targeting gRNA was used as control as described previously (Karottki et al., 2020 (link)).
Xiong K., la Cour Karottki K.J., Hefzi H., Li S., Grav L.M., Li S., Spahn P., Lee J.S., Ventina I., Lee G.M., Lewis N.E., Kildegaard H.F, & Pedersen L.E. (2021). An optimized genome-wide, virus-free CRISPR screen for mammalian cells. Cell Reports Methods, 1(4), 100062.
+ Open protocol
+ Expand
4

Quantifying Cell Viability Using Imaging Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dye master mix was made daily: CD CHO + 8 mM L-glutamine + 5 μg/mL Hoechst-33342 (Life Technologies) + 0.4 μg/mL propidium iodide (Life Technologies). Master mix (200 μL) and cell suspension (3 μL) were mixed in a 96-well optical-bottom microplate (Greiner Bio-One, Frickenhausen, Germany) and cells were incubated for 40 min at RT. Image cytometry analysis was performed on a Celigo Imaging Cell Cytometer (Nexcelom Bioscience, MA, USA). Cells were identified using the blue channel (Hoechst-positive cells), and the red fluorescence channel (propidium iodide) was used to detect dead cells. Total cell density was computed from the total number of identified cells in the well. Cell viability was defined as the percentage of propidium iodide-negative cells. Based on total cell density and viability, viable cell density (VCD) was determined.
For comparison, VCD measurements were performed on a NucleoCounter NC-200 Cell Counter (ChemoMetec, Allerod, Denmark) using Via1-Cassettes™ using a Viability and Cell Count Assay (NucleoView software ver. 1.1.18.1) according to the manufacturer’s instructions.
Hansen H.G., Nilsson C.N., Lund A.M., Kol S., Grav L.M., Lundqvist M., Rockberg J., Lee G.M., Andersen M.R, & Kildegaard H.F. (2015). Versatile microscale screening platform for improving recombinant protein productivity in Chinese hamster ovary cells. Scientific Reports, 5, 18016.
+ Open protocol
+ Expand
5

CHO Cell Growth in Asparagine-Free Media

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO-S (Life Technologies) and CHO-K1 (ATCC CCL-61 adapted to grow in suspension, serum-free conditions) cells were grown in CD-CHO media with and without asparagine at a seeding concentration of 0.4–0.5 × 106 cells/mL. Asparagine was either added via MEM NEAA solution (Control 1) or as an individual amino acid supplementing MEM NEAA solution lacking asparagine (Control 2). Both cell lines were able to grow successfully in media lacking asparagine, as measured by viability and VCD 72 hours after seeding (Supplemental Table S1). Cell growth and viability were monitored using the NucleoCounter NC-200 Cell Counter (ChemoMetec, Allerod, Denmark) based on two fluorescent dyes, acridine orange and DAPI for the total and dead cell populations, respectively.
Hefzi H., Ang K.S., Hanscho M., Bordbar A., Ruckerbauer D., Lakshmanan M., Orellana C.A., Baycin-Hizal D., Huang Y., Ley D., Martinez V.S., Kyriakopoulos S., Jiménez N.E., Zielinski D.C., Quek L.E., Wulff T., Arnsdorf J., Li S., Lee J.S., Paglia G., Loira N., Spahn P.N., Pedersen L.E., Gutierrez J.M., King Z.A., Lund A.M., Nagarajan H., Thomas A., Abdel-Haleem A.M., Zanghellini J., Kildegaard H.F., Voldborg B.G., Gerdtzen Z.P., Betenbaugh M.J., Palsson B.O., Andersen M.R., Nielsen L.K., Borth N., Lee D.Y, & Lewis N.E. (2016). A Consensus Genome-scale Reconstruction of Chinese Hamster Ovary (CHO) Cell Metabolism. Cell systems, 3(5), 434-443.e8.
+ Open protocol
+ Expand
6

Transfection of CHO-S Cells for CRISPR Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO-S cells (Thermo Fisher Scientific) were cultured in CD CHO medium supplemented with 8 mM L-Glutamine (Thermo Fisher Scientific) and 2 μL/mL Anti-Clumping reagent (AC, Life Technologies). Cells were maintained in Erlenmeyer shake flasks (Corning Inc., Acton, MA), incubated in a humidified incubator at 37°C, 5% CO2 at 120 rpm and passaged every 2-3 days. Viable cell density (VCD) and viability were monitored using the NucleoCounter NC-200 Cell Counter (ChemoMetec, Denmark). One day before transfection, cells were seeded into the culture medium without AC. On the day of transfection, cells were transfected using 3.75 μg of DNA packaged with 3.75 μL of FreeStyle Max transfection reagent (Thermo Fisher Scientific) per well of a 6-well plate (BD Biosciences) in 3 mL culture medium without AC and with 1E6 cells/mL. Specifically, for VF gRNA library transfection, 150 μg Bxb1 recombinase plasmid and 450 μg gRNA library donor were transfected into 480 mL CHO-attp-mCherry cells at the density of 1E6 cells/mL. The cells were divided into several 6-well plates and one day after transfection, the cells were combined into two 500 mL flasks. Transfection efficiencies were monitored using the transfection reagent included pmax-GFP plasmid and was generally observed to be between 60-90%.
Xiong K., la Cour Karottki K.J., Hefzi H., Li S., Grav L.M., Li S., Spahn P., Lee J.S., Ventina I., Lee G.M., Lewis N.E., Kildegaard H.F, & Pedersen L.E. (2021). An optimized genome-wide, virus-free CRISPR screen for mammalian cells. Cell Reports Methods, 1(4), 100062.
+ Open protocol
+ Expand
7

Engineered CHO-C1 Cell Line for Glycosylation Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO-S cells (Thermo Fisher Scientific) and a CHO-S mutant with knockouts of Mgat4a,4b and 5, St3gal3,4 and 6, B3gnt2, Sppl3, and Fut8 (referred to here as CHO-C1) were maintained in CD-CHO medium supplemented with 8mM L-glutamine (Thermo Fisher Scientific) and 1 μL/mL Anti-Clumping (AC) reagent (Life Technologies), unless otherwise specified. The cells were cultivated in 125mL Erlenmeyer shake flasks (Corning) in a humidified incubator at 37˚C, 5% CO2 at 120 RPM and passaged every 2–3 days. Viable cell density (VCD) and viability were monitored using the Nucleocounter NC-200 Cell Counter (ChemoMetec). One day prior to transfection, 0.6 × 106 cells/mL cells were spun down at 200x g and resuspended in 6-well plates (BD Biosciences) in 3 mL culture medium without AC per well. Cells were transfected using a total of 3.75 μg DNA and 3.75 μL FreeStyle™ Max transfection reagent (Thermo Fisher Scientific) together with OptiPRO SFM (Life Technologies) according to manufacturer’s protocol. The ratio of DNA used from respective plasmids is listed in Supplementary Table S4. Plasmids for gRNAs targeting Aldh18a1 were transfected into CHO-S cells; those targeting Mgat3 and St6gal1 were transfected into CHO-C1 cells. In addition, non-targeting gRNA with and without dCas9 were transfected for each cell line as controls. All transfections were done in three biological replicates.
Karottki K.J., Hefzi H., Xiong K., Shamie I., Hansen A.H., Li S., Pedersen L.E., Li S., Lee J.S., Lee G.M., Kildegaard H.F, & Lewis N.E. (2019). Awakening dormant glycosyltransferases in CHO cells with CRISPRa. Biotechnology and bioengineering, 117(2), 593-598.
+ Open protocol
+ Expand
8

Necrosis Assay for Cell Viability

Check if the same lab product or an alternative is used in the 5 most similar protocols
Generally, viable cell density (VCD) and viability were monitored using the NucleoCounter NC-200 Cell Counter (ChemoMetec, Denmark). Particularly, necrosis assay was performed in Figure3. 100 μL cell suspension was pelleted and resuspended in 100 μL of staining solution composed of CD CHO cell culture medium supplemented with 5 μg/mL propidium iodide (Carl Roth, Karlsruhe, Germany). Cells were protected from light and incubated for 25 min at RT. Fluorescence assisted cell analysis was performed using a MACSQuant® VYB benchtop flow cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany) equipped with a violet (405 nm), blue (488 nm) and yellow (561 nm) excitation laser. For each sample, a total volume of 25 μL (approximately 20-30 k cells) was analyzed at a flow rate of 100 μL per min. propidium iodide positives were considered as necrotic.
Xiong K., Marquart K.F., la Cour Karottki K.J., Li S., Shamie I., Lee J.S., Gerling S., Yeo N.C., Chavez A., Lee G.M., Lewis N.E, & Kildegaard H.F. (2019). Reduced Apoptosis in Chinese Hamster Ovary Cells via Optimized CRISPR Interference. Biotechnology and bioengineering, 116(7), 1813-1819.
+ Open protocol
+ Expand
9

Efficient Transfection of CHO-S Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO-S cells (Thermo Fisher Scientific) were cultured in CD CHO medium supplemented with 8 mM L-Glutamine (Thermo Fisher Scientific) and 2 μL/mL Anti-Clumping reagent (AC, Life Technologies). Cells were maintained in Erlenmeyer shake flasks (Corning Inc., Acton, MA), incubated in a humidified incubator at 37°C, 5% CO2 at 120 rpm and passaged every 2–3 days. Viable cell density (VCD) and viability were monitored using the NucleoCounter NC-200 Cell Counter (ChemoMetec, Denmark). One day before transfection, cells were seeded into the culture medium without AC. On the day of transfection, cells were transfected using 3.75 μg of DNA packaged with 3.75 μL of FreeStyle Max transfection reagent (Thermo Fisher Scientific) per well of a 6-well plate (BD Biosciences) in 3 mL culture medium without AC and with 1E6 cells/mL. Specifically, for VF gRNA library transfection, 150 μg Bxb1 recombinase plasmid and 450 μg gRNA library donor were transfected into 480 mL CHO-attp-mCherry cells at the density of 1E6 cells/mL. The cells were divided into several 6-well plates and one day after transfection, the cells were combined into two 500 mL flasks. Transfection efficiencies were monitored using the transfection reagent included pmax-GFP plasmid and was generally observed to be between 60–90%.
Xiong K., la Cour Karottki K.J., Hefzi H., Li S., Grav L.M., Li S., Spahn P., Lee J.S., Ventina I., Lee G.M., Lewis N.E., Kildegaard H.F, & Pedersen L.E. (2021). An optimized genome-wide, virus-free CRISPR screen for mammalian cells. Cell Reports Methods, 1(4), 100062.
+ Open protocol
+ Expand
10

Maintenance of Undifferentiated Human ESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Undifferentiated human ESCs H9 (WA09, WiCell Madison, WI) were maintained on tissue culture plates pre-coated with 0.1% gelatine with irradiated C57BL6 mouse embryonic fibroblast feeder cells (25,000 cells/cm2) in H9 ESC media: DMEM/F12 GlutaMAX medium (Thermo Fisher Scientific, 10565018) supplemented KnockOut Serum Replacement (Thermo Fisher Scientific, 10828010), NEAA, beta-mercaptoethanol (Thermo Fisher Scientific, 21985023), and 10 ng/mL FGF2 (Peprotech, 100-18B). Cells were passaged as clusters with collagenase IV (Thermo Fisher Scientific, 17104019) when reaching approximately 70% confluence, and maintained in 20% O2/5% CO2/37°C. Undifferentiated ESC HUES4 WT and PDXeG clone 170-322 (link) were adapted and maintained in DEF-CS (Takara, Y30017). When reaching approximately 80% confluence, cells were dissociated with TrypLE (Thermo Fisher Scientific, 12604013) and counted with the automated NucleoCounter NC-200 cell counter (Chemometec). Cells were re-plated at a density of 40,000 cells/cm2 and maintained in 20% O2/5% CO2/37 °C. All hESC lines were routinely screened for mycoplasma, and all were negative. All cell lines were approved for use in this project by De Videnskabsetiske Komiteer, Region Hovedstadenunder number H-4-2013-057.
Minter R.M., Ferry M.A., Rectenwald J.E., Bahjat F.R., Oberholzer A., Oberholzer C., La Face D., Tsai V., Ahmed C.M., Hutchins B., Copeland EM I.I.I., Ginsberg H.S, & Moldawer L.L. (2000). Extended lung expression and increased tissue localization of viral IL-10 with adenoviral gene therapy. Proceedings of the National Academy of Sciences of the United States of America, 98(1), 277-282.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!