Streptavidin agarose

The DNA oligonucleotides (miR-182, 5'-AAA ACC CAG CCC ACA TTA GCC ATC TCT TCC CCA GCG CCC AGG GGC AGG GCT CT-3'; miR-212, 5'-GAC CGG GGG GGC GGG GCC TCC CAG GTC CCG CCC CGC CCC CAC GCC CCC GCC GG-3'; and p21, 5'- CCC GCC TCC TTG AGG CGG GCC CGG GCG GGG CGG-3') were biotinylated at 5' end and then annealed with their complementary strands. The assay was performed by incubating 1 μg of biotin-labeled probe with cell extract in 1 ml of DAPA buffer (60 mM KCl, 12 mM HEPES, pH 7.9, 4 mM Tris-HCl, 5% glycerol, 0.5 mM EDTA and 1 mM dithiothreitol). After incubation for 1 h at 4℃, DNA–protein complexes were then incubated with 20 μl of streptavidin-agarose (Sigma-Aldrich) for 1 h at 4℃. DNA–protein complexes were then washed three times in the DAPA buffer.

Phenylmethylsulfonyl fluoride (PMSF), Biotin, Wortmannin (WM), Microcystin-LR (MC-LR), N-ethylmaleimide (NEM), dithiothreitol (DTT), 3-aminobenzamide (3-AB), H₂O₂ and streptavidin-agarose were all from Sigma. From Selleck Chemicals we obtained: PARPi AZD2281/Olaparib, used at 2.5 µM; DNA-PKc inhibitor (DPKi) NU7441 (KU57788), used at 10 µM; and bortezomib (BTZ), used at 100 nM. From Tocris we obtained: PARGi PDD00017273, used as indicated, and ATM inhibitor (ATMi) KU-55933, used at 10 µM. IR=gamma rays (¹³⁷Cs) was delivered by GammaCell 1000 Elite (MDS Nordion). A549 (ATCC CCL-185) and HEK293 (ATCC CRL-1573) were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% (v/v) fetal calf serum (FCS), GlutaMAX (Gibco), penicillin and streptomycin. U2OS-2-6-3 cells obtained from Dr. Susan Janicki (Wistar Institute, USA) are described in ref. ^{54 (link)} and were also cultured in DMEM (as above). U2OS 2-6-3 cells stably expressing ER-mCherry-LacR-FokI-DD obtained from Dr. Roger Greenberg are described in ref. ^{26 (link)} were induced for 5 h by 1 µM Shield-1 (Clontech) and 1 µM 4-OHT (Sigma). U2OS XRCC1^−/− cells were obtained from Dr. Keith Caldecott (University of Sussex, UK) and were also cultured in DMEM (as above). All cell lines are tested regularly for mycoplasma contamination and confirmed to be negative. A549 cell identity was confirmed by gene sequencing and karyotyping.

Streptavidin agarose (Sigma-Aldrich) was employed for protein purification. Briefly, 50–100 μL of agarose was packed into a 1.5 mL Eppendorf tube for each sample. The agarose was allowed to settle with a short centrifugation (500×g, 5 min) and the supernatant was discarded. The agarose was washed 4–5 times with binding buffer (PBS containing 1 mM EDTA, 1 mM DTT, 4 µg poly dI. dC as non-specific competitor DNA and protease inhibitor). Simultaneously, the binding reaction with the nuclear protein fraction and the DNA probe was assembled as described above. A 100 μg amount of total nuclear protein was incubated with 4 μg of biotinylated DNA probe at room temperature for 20 min. The reaction was loaded onto the streptavidin column equilibrated with the binding buffer and incubated for another 1 h at room temperature with gentle shaking. Subsequently, the agarose was washed 4–5 times with the binding buffer. After the final wash, the supernatant was aspirated and 10 μL was left above the beads. For protein separation, 20–30 μL pf the SDS loading buffer was added onto the agarose, boiled at 95 °C for 5 min and the sample thus obtained was utilized for electrophoresis.

COS7 cells were seeded at 1.5 × 10⁶ cells/well in a 10 cm dish one day before transfection. Ten micrograms of indicated expression vectors were transfected into COS7 cells using PEI. Forty hours after the transfection, the cells were lysed in 1 mL of TNE buffer. Then, each cell lysate was divided and mixed for DNAP. The combined cell lysates were precleared with 12 μg/mL poly (dI · dC) and streptavidin agarose (Sigma) for 30 min and then incubated with 24 μM biotinylated (AT-motif)₃ for 2 h at 4°C. Subsequently, streptavidin agarose was added to the reaction mixture and incubated for 30 min at 4°C. After the precipitates had been washed with TNE buffer three times, the precipitates and aliquots of the total lysates were separated by SDS-PAGE. The proteins were then transferred to the membrane. The membrane was incubated with the indicated primary antibodies. The primary antibodies were detected as described above. The sequences of the biotinylated (AT-motif)₃ were as follows: 5′-biotinylated CTCGAGGCTGTTAATTATTGGGGCTGTTAATTATTGGGGCTGTTAATTATTGAATTC-3′/3′-GAATTCAATAATTAACAGCCCCAATAATTAACAGCCCCAATAATTAACAGCCTCGAG-5′.

Biotin-modified duplex oligonucleotides (0.5 ml, 25 pmol/µl) containing either two optimal GAS sites (2xGAS) or a permutated sequence thereof (2xnonGAS) were conjugated to streptavidin agarose (0.5 ml packed vol., Sigma-Aldrich) for 1 h at 4°C. Confluent U3A cells (one 10-cm dish) transiently expressing recombinant, untagged STAT1 were either left untreated or stimulated for 30 min with IFNγ and 15 min in the additional presence of vanadate/H₂O₂ before being lysed in a total volume of 400 µl extraction buffer, as described above. After pre-clearing with streptavidin agarose, 320 µl of the extracts were rotated with 50 µl (packed vol.) of DNA-conjugated beads for 2 h at 4°C. The beads were washed with cytoplasmic extraction buffer (400 µl), bound proteins were eluted by boiling in SDS sample buffer and analyzed by Western blotting.