Klenow fragment polymerase
The Klenow fragment polymerase is a DNA polymerase enzyme derived from the DNA polymerase I of Escherichia coli. It retains the 5' to 3' polymerase activity and 3' to 5' exonuclease activity of the full-length enzyme, but lacks the 5' to 3' exonuclease activity.
Lab products found in correlation
7 protocols using klenow fragment polymerase
Viral RNA Extraction and Sequencing
Viral RNA Extraction and Targeted PCR Amplification
Sequencing Human Brain Transcripts
Virus Particle Purification and Nucleic Acid Extraction
Viral Nucleic Acid Extraction and Sequencing
STAT1 DNA-Binding Assay via EMSA
M67; | 5’–CGACAT |
2x GAS; | 5’–CGT |
GAS-non-GAS; | 5‘–CGT |
2x non-GAS; | 5’–CGTTTACCCCAAATTGACGGATTTACCCCAAC–3’. |
Comparative DNA Polymerase Evaluation
Bst DNA polymerase Large fragment (Bst LF), Bst 2.0 DNA polymerase (Bst 2.0), Bst 2.0 WarmStart DNA polymerase (Bst 2.0 WS), Bst 3.0 DNA polymerase (Bst 3.0), Klenow fragment polymerase (Klenow), Klenow fragment exo- polymerase (Klenow (exo-)), Vent exo- DNA polymerase (Vent (exo-)), and dNTP Mix were purchased from New England Biolabs. Bsm DNA polymerase, Maxima H Minus Reverse Transcriptase (MHM), Nuclease-Free Water were purchased from Thermo Fisher Scientific. BcaBEST RNA PCR kit Ver.1.1, z-Taq, RTase M-MLV (RNase H-), Reverse Transcriptase XL (AMV) were purchased from Takara. All synthetic oligonucleotides were purchased from Sangon Biotech (Shanghai, China)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!