Individual E8.5 mouse embryo head and tail tissues post culturing were collected into 1.5mL tubes and flash froze on dry ice with minimal DEPC-Tyrode’s buffer remained in the tube. RNA was extracted using the Qiagen miRNeasy Micro Kit (Qiagen #217084) with on-column DNase treatment. RNA concentration was determined by Nanodrop. The SuperScript™ III First-Strand Synthesis System (Invitrogen #18080051) was used to synthesize cDNA for qRT-PCR with random hexamer primers, and qRT-PCR was performed on an ABI7000 (Thermo QuantStudio 7) using Perfecta SYBR Green (Quantbio #95072-250). Primers are listed in Supplemental Table 2 . No template and no reverse transcription controls were run as negative controls. ΔΔCt method was used to calculate fold change. One-way ANOVA was used for statistical analysis and significance was determined based on p < 0.05.
Abi 7000
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The ABI 7000 is a real-time PCR system designed for quantitative gene expression analysis. It utilizes fluorescence-based detection to monitor the amplification of DNA samples during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
Sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Rnaeasy kit, by Qiagen (3 mentions)
Lightcycler faststart dna master sybr green 1, by Roche (3 mentions)
Superscript 3, by Thermo Fisher Scientific (3 mentions)
Taqman genotyping master mix, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Superscript 3 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (3 mentions)
Dnase 1, by Takara Bio (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Taqman probe, by Thermo Fisher Scientific (2 mentions)
Histopaque 1077, by Merck Group (2 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Mirneasy micro kit, by Qiagen (1 mentions)
Talent qpcr premix sybr green, by Tiangen Biotech (1 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
58 protocols using abi 7000
1
Quantifying Gene Expression in Mouse Embryo
2
Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
K562 cells from each experimental group were collected and washed three times with cold PBS, and then total cell mRNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. cDNA was synthesized from 2 µg total RNA using a first-strand cDNA synthesis kit (Thermo Fisher Scientific, Inc.). The PCR amplification protocol was as follows: Denaturation at 94°C for 10 min, followed by 40 cycles of 94°C for 15 sec, 58°C for 30 sec and 72°C for 40 sec. The mRNA expression levels of VDR, Bcl-2, survivin, Bax, p21, p27 and β-actin were detected using ABI 7000 (Thermo Fisher Scientific, Inc.) and Talent qPCR PreMix (SYBR-Green) (Tiangen Biotech Co., Ltd). The relative quantification based on the relative expression of target genes was calculated using the 2−ΔΔCq method (18 (link)). The PCR primers were designed based on the corresponding gene structure, and the sequences are listed in Table I . RT-qPCR was performed in triplicate.
3
Quantifying Osteogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from tissues using TRIzol Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. Genomic DNA was removed using DNase I (Takara Bio, Otsu, Japan) and cDNA was synthesized from the total RNA using the Superscript RT-PCR system. Osteopontin, Runx2, and fibronectin mRNA levels were semi-quantified by qRT-PCR using an ABI7000 (Thermo Fisher Scientific) with RT2 SYBR Green Master Mix (Qiagen, Hilden, Germany) and a Rat osteogenesis PCR Array (Qiagen) according to the manufacturer’s instructions.
4
Gene Expression Profiling by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissue specimens and cell lines using the RNAeasy kit (Qiagen, USA). LightCycler FastStart DNA Master SYBR green I (Roche, USA) was used for amplification in a total volume of 20 μl. According to Ct value, we calculated the sample cDNA copy number by using the standard curves, and then analyzed PCR results by ABI7000 software (Applied Biosystems, Foster City, CA, USA). Gene-specific primers for CTHRC1, CD133, CD44, N-cadherin, vimentin, E-cadherin and β-actin were designed using the Primer Premier software (Premier Biosoft International, Palo Alto, CA) as listed in Table 5 . β-actin was used as an internal reference.
5
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from tissue specimens using the RNAeasy kit (Qiagen, USA). The amplification was carried out in a total volume of 20 μL containing LightCycler FastStart DNA Master SYBR green I (Roche, USA). Ct value (initial amplification cycle) of each standard dilution was plotted against standard cDNA copy numbers. By using the standard curves for each gene, the sample cDNA copy number was calculated according to the sample Ct value. Standard curves and PCR results were analyzed using ABI7000 software (Applied Biosystems, Foster City, CA, USA). Primers were CTHRC1: (sense) 5′-TGG ACA CCC AAC TAC AAG CA-3′ and (antisense) 5′-GAA CAA GTG CCA ACC CAG AT-3′. β-actin (primers: sense 5′-GCA TGG GTC AGA AGG ATT CCT-3′, antisense 5′- TCG TCC CAG TTG GTG ACG AT-3′) was used as an internal reference.
6
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNAeasy kit (Qiagen, USA). The amplification was carried out in a total volume of 20 μL containing LightCycler FastStart DNA Master SYBR green I (Roche, USA). Ct value (initial amplification cycle) of each standard dilution was plotted against standard cDNA copy numbers. On the basis of the standard curves for each gene, the sample cDNA copy number was calculated according to the sample Ct value. Standard curves and PCR results were analyzed using ABI7000 software (Applied Biosystems, Foster City, CA, USA). Primers were β-catenin: (sense) 5′GTTTCGTTTCCGCTGTTA 3′, (antisense)5′ TTTCTCCCTCTTGCCATC 3′ and AEG-1: (sense) 5′CGAGAAGCCCAAACCAAATG 3′, (antisense) 5′TGGTGGCTGCTTTGCTGTT 3′. β-actin (primers: sense 5′ GCATGGGTCAGAAGGATTCCT 3′, antisense 5′ TCGTCCCAGTTGGTGACGAT 3′) was used as an internal control.
7
Quantitative PCR Analysis of Mouse Lung MD2
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cancer cell lines using RNAeasyTM kit (Beyotime Institute of Biotechnology), according to the manufacturer's protocols, and the concentration of RNA was determined on an ultraviolet spectrophotometer (NanoDrop 2000; Thermo Fisher Scientific, Inc.). Next, 1 µg RNA was reverse transcribed (42˚C for 50 min) into first-strand cDNA using the BeyoRTTM III cDNA kit (Beyotime Institute of Biotechnology). Next, qPCR was performed on an ABI7000 (Applied Biosystems; Thermo Fisher Scientific, Inc.) using SYBR-Green qPCR mix (Shanghai Yeasen Biotechnology Co., Ltd.). β-actin was the internal control. The primers for qPCR are listed in Table I . The thermocycling conditions were as follows: 95˚C for 2 min; (95˚C for 10 sec; 60˚C for 15 sec) for 40 cycles. The relative mRNA levels of target genes were calculated using the 2-∆∆Cq method (31 (link)).
9
Quantifying miRNA-1297 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell and tissue samples (hippocampus) using the TRIzol® reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). mRNA (1 ng) was reverse transcribed into cDNA with a ReverTra Ace-α first strand cDNA synthesis kit (Toyobo, Osaka, Japan). The PCR reaction was performed using a qPCR instrument (ABI 7000; Applied Biosystems, Foster City, CA, USA) and the Express SYBR® GreenER™ miRNA qRT-PCR kit (Invitrogen Life Technologies) with the following PCR conditions: 95°C for 10 minutes; 40 cycles of 95°C for 10 s, 60°C for 20 s, and 72°C for 30 s; and 72°C for 10 minutes. MiRNA-1297 expression was determined using the 2−ΔΔCt method.
10
Genotyping SNPs rs3931020 and rs13144478
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SNPs rs3931020 and rs13144478 were genotyped by Taqman SNP allelic discrimination technique by means of an ABI 7000 (Applied Biosystems, Foster City, CA) as previously described32 (link), 49 (link). Call rate and concordance rate were ≥96 and >99%, respectively.
The SNPs were in Hardy–Weinberg equilibrium (HWE) with the exception of rs3931020, p = 0.03 in FMS.
The SNPs were in Hardy–Weinberg equilibrium (HWE) with the exception of rs3931020, p = 0.03 in FMS.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!