Lenticas9 puro

Manufactured by Addgene

The LentiCas9-puro is a lentiviral plasmid that expresses the Cas9 endonuclease protein from Streptococcus pyogenes and a puromycin resistance gene. This plasmid is designed for the delivery and stable expression of Cas9 in target cells.

Automatically generated - may contain errors

Lab products found in correlation

Lenticas9 blast, by Addgene (2 mentions) Plko 1 puro vector, by Addgene (1 mentions) Lenticrispr v2, by Addgene (1 mentions)

2 protocols using lenticas9 puro

Constructing Expression Vectors for DPF3 and SNIP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression vector encoding human DPF3a and DPF3b were constructed by replacing the Cas9 cassette on lentiCas9-Blast (Addgene) with the HA-tagged DPF3a/DPF3b coding sequence followed by T2A and mCherry cassettes. The expression vector encoding human SNIP1 was constructed by replacing the Cas9 cassette on lentiCas9-puro (Addgene) with a Flag-tagged SNIP1 coding sequence by T2A and GFP cassettes. The shRNAs targeting SNIP1 were cloned into the PLKO.1-puro vector (Addgene). The lenti-Luciferase plasmid was constructed by replacing the Cas9 cassette on lentiCas9-puro or lentiCas9-Blast (Addgene) with a luciferase cassette. Bacterial expression vectors for DPF3a and SNIP1 were constructed by subcloning the cDNA sequences into the pGEX-6P-1 vector.

Cui H., Yi H., Bao H., Tan Y., Tian C., Shi X., Gan D., Zhang B., Liang W., Chen R., Zhu Q., Fang L., Gao X., Huang H., Tian R., Sperling S.R., Hu Y, & Chen W. (2022). The SWI/SNF chromatin remodeling factor DPF3 regulates metastasis of ccRCC by modulating TGF-β signaling. Nature Communications, 13, 4680.

+ Open protocol

+ Expand

Lentiviral Plasmid Construction for Human Chemokine Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate lentiviral plasmid expressing human chemokine receptors, CXCR1 and CXCR3 cDNA from CXCR1-Tango (Addgene, #66259) and CXCR3-Tango (Addgene, #66261), respectively, were amplified and subcloned into lentiCas9-blast (Addgene, #52962) with restriction enzymes Age1 and BamH1 to replace SpCas9; CXCR5 and CXCR6 cDNA from CXCR5-Tango (Addgene, #66263) and CXCR6-Tango (Addgene, #66264), respectively, were amplified and subcloned into lentiCas9-puro to replace SpCas9 where blasticidin-resistant gene (blast) was also replaced with puromycin-resistant gene (puro). For CRISPR editing, control guide (sgScramble, GCTTAGTTACGCGTGGACGA) and guides targeting to human CXCR4 gene (sgCXCR4-1, TGACATGGACTGCCTTGCAT; sgCXCR4-2, CAACCACCCACAAGTCATTG; sgCXCR4-3, CAGGACAGGATGACAATACC) or human RGS14 gene (sgRGS14-1, GCAGGGATCTGTGAGAAACG; sgRGS14-2, TCGGCAGCCCTGACGCCACG; sgRGS14-3, CTGAGACTCTCGGCGCAAGG) were cloned into the vector lentiCRISPR-v2 (Addgene, #62961).

Biasci D., Smoragiewicz M., Connell C.M., Wang Z., Gao Y., Thaventhiran J.E., Basu B., Magiera L., Johnson T.I., Bax L., Gopinathan A., Isherwood C., Gallagher F.A., Pawula M., Hudecova I., Gale D., Rosenfeld N., Barmpounakis P., Popa E.C., Brais R., Godfrey E., Mir F., Richards F.M., Fearon D.T., Janowitz T, & Jodrell D.I. (2020). CXCR4 inhibition in human pancreatic and colorectal cancers induces an integrated immune response. Proceedings of the National Academy of Sciences of the United States of America, 117(46), 28960-28970.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!