Big dye terminator ready reaction mix

Amplification of coding regions and at least 50 base pairs of flanking non-coding regions was performed using primers reported previously by Afzal et al., 2019 [20 (link)]. 25μl polymerase chain reaction (PCR) was performed for both affected and non-affected individuals following protocol described by Afzal et al., 2019 [20 (link)]. After amplification, 1.5% agarose gel was prepared to load samples and controls along with DNA ladder (1kb) to separate bands according to their sizes. Purification was done using instructions provided by manufacturer of PCR purification kit (Wiz Bio Solutions, Seongnam, Korea). Finally, each amplified product was sequenced using big dye terminator ready reaction mix (Applied Biosystems, Foster City, CA, USA) in an automated ABI 3100 genetic analyzer. Sequencing results were analyzed by aligning them to reference sequence NM_000104.4 using Sequencher software (5.4.6) and Codon Code Aligner program to identify sequence variations. After identification of each variant, their disease causing potential was checked using Mutation taster (https://www.mutationtaster.org/) [24 (link)]. Furthermore, segregation with disease phenotype was confirmed by sequencing other available family members. Each novel identified sequence variant was checked in 96 control samples.

Constructs and modifications to the Kcnj13 gene were amplified using primers shown in Supplementary Table S1. PCR reagents included: 10x PCR buffer: 1.0 ul, Mg2+ 0.6 ul, dNTP 0.5 ul, 10 pm primer 0.5 + 0.5 ul. Taq 1 u, DNA 40 ng, H2O up to 10 ul. Cycling including a touchdown PCR reaction for the first 15 cycles: 94 °C for 4 min, followed by decreasing the annealing temperature from an initial 64 °C in a stepwise fashion by 0.5 °C every second cycle. For the later 20 cycles: 94 °C for 40 sec, 57 °C for 30 sec and 72 °C for 1.5 min, and finally a prolonged elongation step at 72 °C for 10 min. PCR product was purified and analyzed by Sanger sequencing using an ABI 3130 sequencer with Big Dye Terminator Ready reaction mix according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA). Sequencing results were analyzed using Mutation Surveyor v3.30 (Soft Genetics, State College, PA) or DNASTAR Navigator 17 (DNASTAR, Madison, WI).

Total tail DNA and retinal RNA were extracted using Qiagen kits. The quality and quantity of DNA and RNA were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The RNA was reverse transcribed to cDNA by Invitrogen SuperScript III reverse transcriptase kit (Invitrogen, Waltham, MA, USA). PCR products were purified and analyzed by Sanger sequencing using an ABI 3130 sequencer with Big Dye Terminator Ready reaction mix, according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). Sequencing results were analyzed using Mutation Surveyor v3.30 (Soft Genetics, State College, PA, USA) or DNASTAR Navigator 17 (DNASTAR, Madison, WI, USA).

Genomic DNA (2.5 ng/μl, 10 μl reactions) was amplified (35 cycles) in a GeneAmp 9700 thermal cycler using Top Taq mastermix kit (Qiagen) and 20 pmol of gene-specific primers (Additional file 6). Resulting PCR amplicons were enzyme-purified with ExoSAP-IT (USB Corporation, Cleveland, OH). The purified amplicons were direct cycle-sequenced in both directions with BigDye Terminator Ready Reaction Mix (v3.1)(Applied Biosystems, Grand Island, NY) containing M13 forward or reverse sequencing primers, then ethanol precipitated and detected by capillary electrophoresis on a 3130xl Genetic Analyzer running Sequence Analysis (v.6.0) software (Applied Biosystems) and Chromas (v2.23) software (Technelysium, Tewantin, Queensland, Australia).

1162 bp of the EPHA2 promoter region were amplified using primers: EPHA2-promoter-F: CCGCTTCCCAAGAGTAGGCACCA; EPHA2-promoter-R: CCCTCCTGCCCCGAGTCCTTAAT. PCR reagents included: 10x PCR buffer: 1.0 ul, Mg²⁺ 0.6 ul, dNTP 0.5 ul, 10 pm primer 0.5 + 0.5 ul. Taq 1 u, DNA 40 ng, H₂O up to 10 ul. Cycling including a touchdown PCR reaction for the first 15 cycles: 94 °C for 4 min, followed by decreasing the annealing temperature from an initial 64 °C in a stepwise fashion by 0.5 °C every second cycle, and 72 °C for 1.5 min. For the later 20 cycles: 94 °C for 40 sec, 57 °C for 30 sec and 72 °C for 1.5 min and finally a prolonged elongation step at 72 °C for 10 min. PCR production was purified and analyzed by Sanger sequencing using an ABI 3130 sequencer with Big Dye Terminator Ready reaction mix according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA). Sequencing results were analyzed using Mutation Surveyor v3.30 (Soft Genetics, State College, PA) or Lasergene 8.0 (DNASTAR, Madison, WI).