Pmd 18t vector kit

The genomic DNA of the strain was extracted using a SK8255 column bacterial genomic DNA extraction kit (Sangon biotech, Shanghai, China). PCR amplification of the 16SrDNA was performed using the universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT-3). The PCR regime used for amplification was as follows: 94°C for four minutes, followed by 30 cycles consisting of 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for one minute 30 seconds, and a single final extension step of 72°C for 10 minutes. The PCR products amplified from the genomic DNA were purified with a SK8131p column DNAJ gum recycling kit (Sangon biotech, Shanghai, China). A pMD®18-T Vector kit (Takara, Japan) was used for ligation and transformation. DNA sequencing was performed by Shanghai Sangon Biological Engineering Technology and Services Co. Ltd. The sequences were compared to known sequences in NCBI, and an unrooted phylogenetic tree of the strains was constructed using the neighbor-joining method in the MEGA version 5.0 software.

The VGSC gene of Ae. albopictus contains four domains (I–IV), and nonsynonymous point mutations have been found only in Domain II, III, and IV [17 (link), 32 (link)]. To detect point mutations in VGSC, fragments from Domain II, III, and IV were amplified via PCR under the same conditions. The 20 μL reaction mixture contained genomic DNA as templates, 10 μL of premix Taq (Aidlab, Beijing, China), 0.5 μL each of forward and reverse primers, 1 μL of genomic DNA, and 8 μL of ddH₂O. The PCR reaction was conducted in a ProFlex PCR System (Applied Biosystems, Thermo Fisher Scientific), with the following cycling conditions: 94°C for 2 min, followed by 35 cycles at 94°C for 30 s, 60°C for 30 s, and 68°C for 30 s, with a final extension at 68°C for 8 min. The amplified products were detected using 1.5% agarose gel electrophoresis and sequenced using the Sanger sequencing method by BioSune Biotechnology Co., Ltd. The amplification and sequencing primers were the same and are listed in Table 2 [17 (link)].
To distinguish the aberrant peaks in the sequence data, TA cloning was performed on the PCR products of several individuals for Domain III using a pMD 18-T Vector Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions for cloning and sequencing.