The total RNA was extracted using the MolPure® Blood RNA Kit (19241ES50, YEASEN) or MolPure® Cell RNA Kit (19231ES50, YEASEN) based on the sample type. Subsequently, we used the lnRcute lncRNA First-Strand cDNA Kit (KR202, TIANGEN) or FastKing gDNA Dispelling RT SuperMix (KR118, TIANGEN) to conduct reverse transcription. The cDNA was then analyzed by RT-qPCR using lnRcute lncRNA qPCR Kit (FP402, TIANGEN) or SuperReal PreMix Plus (SYBR Green) (FP205, TIANGEN) on the QuantStudio 3 system (Applied Biosystems, Waltham, MA, USA). The PCR primers are shown in Table S10 . Expression data were normalized to the expression of β-actin with the 2−ΔΔCt method.
Lnrcute lncrna qpcr kit
Manufactured by Tiangen Biotech
Sourced in China
The LnRcute lncRNA qPCR Kit is a laboratory equipment product designed for the detection and quantification of long non-coding RNA (lncRNA) molecules using real-time quantitative PCR (qPCR) technology. The kit provides the necessary reagents and protocols for efficient lncRNA analysis in research applications.
Automatically generated - may contain errors
Lab products found in correlation
Lnrcute lncrna first strand cdna kit, by Tiangen Biotech (5 mentions)
Rnasimple total rna kit, by Tiangen Biotech (3 mentions)
Quantstudio 3 system, by Thermo Fisher Scientific (2 mentions)
Molpure blood rna kit, by Yeasen (2 mentions)
Quantstudio 5, by Thermo Fisher Scientific (2 mentions)
Aceq qpcr sybr green master mix, by Vazyme (2 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Molpure cell rna kit, by Yeasen (1 mentions)
Superreal premix plus sybr green, by Tiangen Biotech (1 mentions)
Fastking gdna dispelling rt supermix, by Tiangen Biotech (1 mentions)
Hiscript 2 q select rt supermix for qrt pcr, by Vazyme (1 mentions)
Paris kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
6 protocols using lnrcute lncrna qpcr kit
1
lncRNA Expression Quantification Protocol
2
Comprehensive RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclear and cytoplasmic RNA extraction was performed using the PARIS™ Kit (Invitrogen), and the total RNA was isolated from the cells and skin using the RNAsimple total RNA Kit (Tiangen, Beijing, China), according to the manufacturer’s instructions. For mRNA verification, total RNA (1 μg) was reverse transcribed using the HiScript II Q Select RT SuperMix for qRT-PCR (Vazyme, Nanjing, China), and cDNA (10 ng) was used for the quantitative mRNA analysis, which was performed using AceQ qPCR SYBR® Green Master Mix (Vazyme, Nanjing, China). For lncRNA verification, the lnRcute lncRNA First-Strand cDNA Kit (Tiangen, Beijing, China) was used for cDNA synthesis, and the lnRcute lncRNA qPCR Kit (SYBR Green, Tiangen, Beijing, China) was used for qRT-PCR. The data were analyzed using QuantStudio® 5 (Applied Biosystems, Massachusetts, USA), according to the manufacturer’s instructions. The relative expression levels were calculated using the 2−ΔΔCt method [28 (link)] and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the reference gene. U6 RNA served as a positive control for the nuclear gene expression. The specific primers are listed in Table S4 .
3
Transcriptome Analysis Using qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, the total RNA of cells and skins was isolated using the RNAsimple total RNA Kit (Tiangen, Beijing, China). For the verification of the mRNA expression level, the AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) was used for quantitative mRNA level analysis. For the verification of the lncRNA expression level, cDNA synthesis was performed using the lnRcute lncRNA First-Strand cDNA Kit (Tiangen, Beijing, China), and then qRT-PCR was performed using the lnRcute lncRNA qPCR Kit (SYBR Green, Tiangen, Beijing, China). The qRT-PCR data were analyzed using QuantStudio 5 (Applied Biosystems), according to the manufacturer’s instructions. Relative expression levels of mRNA and proteins were calculated using the 2−ΔΔCt method [47 (link)], and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the reference gene. The specific primers are listed in Table S4 .
4
Quantitative Analysis of lncRNA SNAI3-AS1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNAsimple Total RNA Kit (DP419, Tiangen Biotech Co., Ltd. Beijing, China) was used to extract total RNA from tissue and cells. The lnRcute lncRNA First-Strand cDNA Kit (KR202, Tiangen Biotech Co., Ltd.) was used to construct complementary DNA. The lnRcute lncRNA qPCR Kit (FP402, Tiangen Biotech Co., Ltd.) was used to perform RT-qPCRs according to the manufacturer’s instructions. To evaluate relative gene expression, the 2−ΔΔCt method was utilized. GAPDH was used as an endogenous control. The primer sequences were as follows: SNAI3-AS1, 5-TGAGGTGCTCCTCCGAGAAT-3 (Forward) and 5-GTATAGCTCCCTGGCAGAGTTCA-3 (Reverse); GAPDH, 5-CAGGAGGCATTGCTGATGAT-3 (Forward) and 5GAAGGCTGGGGCTCATTT-3 (Reverse).
5
qRT-PCR for lncRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell lines using trizol (Invitrogen). For qRT-PCR, 1 µg of RNA was directly reverse transcribed using an lnRcute lncRNA First-Strand complementary DNA (cDNA) synthesis kit [with genome DNase (gDNase); KR202, TIANGEN BIOTECH Co., Ltd., Beijing, China] containing oligo(dT) primers, and RNA expression was evaluated by qRT-PCR with an lnRcute lncRNA qPCR kit (SYBR Green, FP402-02, TIANGEN BIOTECH) and a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). Human primers were used in this study. Beta-actin (ACTB) was used as the internal control, and the fold change in target gene expression was calculated by the delta delta Ct method. All data are mean ± standard deviation (SD). Each experiment was repeated at least 3 times (32 (link),33 (link)). The primers are listed in Table S2 .
6
Quantifying lncRNA Expression in T2DM
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The blood samples in qRT-PCR experiment were from a cross-sectional survey in Jilin Province. There were 125 T2DM patients and prediabetes who met the inclusion criteria, respectively. Meanwhile, based on the matching of gender and age, we selected the corresponding control blood samples. The total RNA was extracted using the MolPure® Blood RNA Kit (19241ES50, YEASEN) based on the manufacturer’s instructions. Subsequently, we used lnRcute lncRNA First-Strand cDNA Kit (KR202, TIANGEN) to conduct reverse transcription. The cDNA was then analyzed by qRT-PCR using lnRcute lncRNA qPCR Kit (FP402, TIANGEN) on QuantStudio 3 system (Applied Biosystems). The PCR amplification was performed with one cycle at 95°C for 3 min, followed by 40 cycles at 95°C for 5 sec, at 55°C for 10 sec, and at 72°C for 15 sec. The following PCR primers were used: ENST00000503273 primers, forward: 5′- CCTGCCCGCTATGTGACCAATG -3′, reverse: 5′- ACTCCAGCCTGTATCTTCCTCCATC -3′; ENST00000462720 primers, forward: 5′- CTGTGCTTCTGCTTGACTGAGGATC -3′, reverse: 5′-AGGGTGACTGTGAGAGGGTGATG -3′; ENST00000480633 primers, forward: 5′- GAGCCTCGTTCACGGTTCTATGC -3′, reverse: 5′- CAGCCAGCTTGCAGTGACCTTC -3′; ENST00000485392 primers, forward: 5′- TGACGATGAGGTGGCGGTAA -3′, reverse: 5′- GCTCTCGCTGAAACCAGTCC -3′. Expression data were normalized to the expression of β-actin with the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!