Total RNA of colon tissues was isolated using RNAiso Plus reagent (Takara) [21 (link)]. Five hundred nanograms of total RNA were reversely transcribed using RT Master Mix (Takara). Quantitative real-time PCR was performed in an Applied Biosystems 7500 System with TB Green Premix Ex Taq II (Takara). Gene transcript levels were normalized to actin. The primers used for real-time PCR assays were 5′-GCCTTCTTGGGACTGATGCT-3′ and 5′-CTGCAAGTGCATCATCGTTGT-3′ for Il6; 5′-CTCCAGAAGGCCCTCAGACTAC-3′ and 5′-AGCTTTCCCTCCGCATTGACACAG-3′ for Il17a; 5′-CCTCTAGCTGGAACACAGTGC-3′ and 5′-GCGGTTCTCATCTGTGTCG-3′ for Il17c; 5′-GACCAAACTCAGCAATCAGCTC-3′ and 5′-TACAGACGCAAGCATTTCTCAG-3′ for Il22; 5′-TCCCTACTAGGACTCAGCCAAC -3′ and 5′-TGGGCATCTGTTGGGTCT-3′ for Il23p19; 5′-AGTGTCCTCAGTTTGTGCAG-3′ and 5′-ACTCCTTGTGGCTGTCTTTG-3′ for S100a8; 5′-TTAAAAACCTGGATCGGAACCAA-3′ and 5′-GCATTAGCTTCAGATTTACGGGT-3′ for Ccl2; 5′-AGCAGTCCAACTCCGGGGAACAG-3′ and 5′-GTCGATCAGCGTGGTGGCGATG-3′ for Tipe and 5′-CCACACCCGCCACCAGTTCG-3′ and 5′-TACAGCCCGGGGAGCATCGT-3′ for Actin. The relative changes in gene expression were analyzed by the 2-Δct or 2-ΔΔct method, and specificity of qPCR amplification was assessed by melting curve analysis.
7500 system
Manufactured by Takara Bio
Sourced in United States
The 7500 System is a real-time PCR instrument designed for gene expression analysis, genotyping, and other molecular biology applications. It provides reliable and precise quantification of target DNA sequences in a wide range of sample types. The system includes software for data analysis and reporting.
Automatically generated - may contain errors
Lab products found in correlation
Rnaiso plus reagent, by Takara Bio (1 mentions)
Tb green premix ex taq 2, by Takara Bio (1 mentions)
Rt master mix, by Takara Bio (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Trizol reagent, by Beyotime (1 mentions)
One step sybr primescript plus rt pcr kit, by Takara Bio (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
4 protocols using 7500 system
1
Colon Tissue RNA Extraction and qPCR
2
Quantifying Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Beyotime) was used to isolate RNA sample from cultured cells. Then, RNA was reverse transcribed into complementary DNA using PrimeScript RT kit (Takara, Dalian, Liaoning, China). RT-qPCR was conducted at ABI 7500 system (Foster City, CA, USA) using SYBR Green (Takara). Relative gene expression level was calculated with 2−ΔΔCt method. Primers used were: PART1: 5ʹ‐AAGGCCGTGTCAGAACTCAA‐3ʹ (forward) and 5ʹ‐GTTTTCCATCTCAGCCTGGA‐3ʹ (reverse); HMGB2: 5ʹ‐GGGGAAGAAAAAGGACCCCA‐3ʹ (forward) and 5ʹ‐GCTGACTGCTCAGACCACAT‐3ʹ (reverse); GAPDH: 5ʹ-AACGTGTCAGTGGTGGACCTG-3ʹ (forward); and 5ʹ-AGTGGGTGTCGCTGTTGAAGT-3ʹ (reverse); miR-590-3p: 5ʹ-GCGCTAATTTTATGTATAA-3ʹ (forward); and 5ʹ-GTGCAGGGTCCGAGGT-3ʹ (reverse); U6 snRNA: 5ʹ‐CTCGCTTCGGCAGCACA‐3ʹ (forward) and 5ʹ‐AACGCTTCACGAATTTGCGT‐3ʹ (reverse).
3
Tissue-specific RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver and colon tissues using an RNA kit (Qiagen, Germantown, MD, United States) according to the manufacturer’s protocol. Real-time PCR was performed with the Applied Biosystems 7500 system using the one-step SYBR PrimeScript plus RT-PCR kit (Takara, Japan). The PCR primer sequences used in this study are listed in Supplementary Table S1 . The expression data of the samples were normalized to those of the internal control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and were calculated according to the ΔΔCt method.
4
Validating RNA-seq by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thirteen genes were randomly selected to quantify the validity of RNA-seq by qRT-PCR in three duplicates. qRT-PCR was performed using cDNA templates of samples from the control and heat treatment groups. cDNA was synthesized from total RNA using the PrimeScriptTMII 1st Strand cDNA Synthesis Kit (TaKaRa) according to the recommended protocol. To test the integrity of cDNA templates, Ribosomal protein 10 (RPL10) was selected as a housekeeping gene (Li et al., 2018 ). The qRT-PCR primers (Supplementary Table S1 ) were designed online7 . The cDNA templates in 10-fold dilution series were used to construct a relative standard curve to determine the PCR efficiency, and all primers reached amplification efficiencies of 95–100%.
qRT-PCR was performed in an Applied Biosystem 7500 System (United States) using SYBR Premix Ex Taq II (TaKaRa), according to the manufacturer’s protocol. The cycling conditions were as follows: (i) 95°C, 30 s; (ii) 95°C, 5 s; (iii) 60°C, 34 s; and (iv) repeat (ii–iii) for 40 cycles. The procedure was followed by an analysis of melting curves ranging from 60°C to 95°C to verify the presence of a single and discrete peak for each reaction product. Each reaction was run in triplicate, and the average threshold cycle (Ct) was calculated for each replicate. The results of qRT-PCRs were analyzed by the 2–ΔΔCT method (Livak and Schmittgen, 2001 (link)).
qRT-PCR was performed in an Applied Biosystem 7500 System (United States) using SYBR Premix Ex Taq II (TaKaRa), according to the manufacturer’s protocol. The cycling conditions were as follows: (i) 95°C, 30 s; (ii) 95°C, 5 s; (iii) 60°C, 34 s; and (iv) repeat (ii–iii) for 40 cycles. The procedure was followed by an analysis of melting curves ranging from 60°C to 95°C to verify the presence of a single and discrete peak for each reaction product. Each reaction was run in triplicate, and the average threshold cycle (Ct) was calculated for each replicate. The results of qRT-PCRs were analyzed by the 2–ΔΔCT method (Livak and Schmittgen, 2001 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!