Quantstudio 6 qpcr instrument

Total DNA was isolated from either dissected ovary (from individual adult females under sterile PBS), eggs (n = 30), or the whole tick at different life stages using the PowerSoil Kit (Mobio) according to the manufacturer’s instructions. DNA was eluted in 100 μL with concentrations ranging from 1.8 ng/μL to 14.7 ng/μL. Midichloria mitochondrii was quantified as described by (Sassera et al., 2008 (link)). The real-time PCR reaction mixture contained 2 μL of DNA, 10 μL of SYBR green (Roche, 4913914001), 1 μL of each primer (10 pmol) (F: 5’CTTGAGAGCAGAACCACCTA 3’; R: 5’CAAGCTCTGCC GAAATATCTT 3’) and DNA-free water (Top-Bio, Praha, Czech Republic) to 20 μL. The I. ricinus single-copy gene elongation factor-1α (ef-1α; ID: GU074769.1) was used as a reference for data normalization and also as a control for the DNA isolation procedure (F: 5’ACGAGGCTCTGACGGAAG 3’; R: 5’CACGACGCAACTCCTTCAC 3’). The reaction was carried out in a QuantStudio 6 qPCR instrument (Applied Biosystems) with 50 cycles at 95 °CC (10 s), 60 °CC (10 s), and 72 °CC (10 s) following an initial denaturation at 95 °CC (10 min). The samples were considered free of M. mitochondrii when no specific amplification of the bacterium could be detected within 50 cycles.

Thermal stabilization (DSF) assays were performed essentially as described (Niesen et al., 2007 (link)), with the following modifications. Purified ZmSIRK1^737-1045 was screened against a library of 378 structurally diverse and cell-permeable ATP-competitive kinase inhibitors library from Selleckchem (Houston, TX, United States; catalog No. L1200). DSF experiments were performed in a 384-well plate format. Each well contained 25 μL of 1 μM kinase in DSF buffer (100 mM K-phosphate, 150 mM NaCl, 10% glycerol, pH 7.5) and the Protein Thermal Shift dye at the recommended concentration of 1:1000 (Applied Biosystems; the composition of the buffer and the dye solutions are not disclosed). Compounds (10 mM) in DMSO were added to 10 μM final concentration (0.1% final DMSO). Plates were sealed using optically clear films and transferred to a QuantStudio 6 qPCR instrument (Applied Biosystems, Singapore). Fluorescence intensity data were acquired in a temperature gradient from 25 to 95°C at a constant rate of 0.05°C/s and protein melting temperatures were calculated based on a Boltzmann function fitting to experimental data, as implemented in the Protein Thermal Shift Software (Applied Biosystems, Singapore). Protein in 0.1% DMSO was used as a reference. Compounds displaying a positive temperature shift (ΔTm) of 2°C or higher compared to the control were considered positive.

Aliquots (2 µL) of the Smart-seq2 cDNAs from single sorted myeloid dendritic cells (mDCs) were diluted 10-fold in low TE (10mM Tris, 0.1mM EDTA) and 2.5 µL of the diluted cDNAs were subjected to 10 µL Taqman™ qPCR assays for the human beta actin (ACTB) housekeeping gene (ThermoFisher Hs01060665_g1 FAM-MGB) using 5 µL of a 2X PerfeCTa qPCR SuperMix ROX (Quantabio cat# 95050-500) as an initial screen for endogenous gene expression. Thermocycling conditions were completed on a Quantstudio 6 qPCR instrument (Applied Biosystems) using the following thermocycling profile: initial 95°C activation for 2 minutes followed by 45 cycles of 95°C for 10 seconds and 60°C for 30 seconds. Positive reactions - cycle threshold (Ct) of less than 35 for ACTB amplification - were identified and their corresponding cDNAs screened using two additional marker genes selected from the NS-Forest analysis, CDKN1C (ThermoFisher Hs00175938_m1 FAM-MGB) and NDRG2 (ThermoFisher Hs01045114_g1 FAM-MGB), using the same thermocyling conditions as for ACTB.

A cell-permeable ATP-competitive kinase inhibitor library from Selleckchem (Houston, TX, United States; catalog No. L1200) was screened to identify interactors for ZmDRIK1-KD. One micromolar of each purified construct of ZmDRIK1-KD was mixed with DSF buffer (100 mM K-phosphate, 150 mM NaCl, 10% glycerol, and pH 7.5) containing 1:1000 SYPRO Orange Protein Thermal Shift Dye (Life Technologies Corporation, Eugene, USA) in a 384-well plate containing 10 μM of each library compound. As compound stocks were stored at 10 mM in 100% DMSO, a control with 0.1% DMSO was used as a reference. Plates were sealed using optically clear films, and fluorescence intensity data were measured in a temperature gradient from 25 to 95 °C at a constant rate of 0.05 °C/s in a QuantStudio 6 qPCR instrument (Applied Biosystems, Singapore). Data were analyzed using the Boltzmann function. Compounds with increased melting temperature by 2 °C or more, in comparison to the control curve, were considered positives.

To extract RNA, cells were resuspended in 1ml Trizol (Thermo Fisher, 15596018) and incubated for 5 minutes at room temperature and stored at at -80°C, or further processed. 200μl chloroform (Millipore Sigma, St. Louis, MO; C2432) was added and mixed, before centrifugation to separate organic and aqueous phases. The aqueous phase was recovered, mixed with 400μl additional chloroform, and centrifuged. The aqueous phase was recovered and RNA was precipitated by addition of isopropanol. Total RNA was quantified using a NanoDrop instrument (Thermo Fisher). cDNA was prepared with Superscript IV and oligo-d(T) primers (Thermo Fisher, 18091050) according to manufacturer’s instructions. qPCR was performed using SYBRgreen Master Mix on an Applied Biosystems QuantStudio 6 qPCR instrument using primers found in S5 Table.

CAMKK1-KD protein was screened against a library of 378 structurally diverse and cell-permeable ATP-competitive kinase inhibitors available from Selleckchem (Houston, TX, United States; catalog No. L1200). DSF measurements were made in a 384-well plate. Each well contained 20 μL of 1 μM kinase in 100 mM potassium phosphate pH 7.0, 150 mM NaCl, 10% glycerol and the Applied Biosystems Protein Thermal Shift dye at the recommended concentration of 1:1000.
The compounds, previously solubilized in DMSO, were used at 10 µM final concentration and 0.1% DMSO. Plates were sealed using optically clear films and transferred to a QuantStudio 6 qPCR instrument (Applied Biosystems). The fluorescence intensity was measured during a temperature gradient from 25 to 95 °C at a constant rate of 0.05 °C/s and protein melting temperatures were calculated based on a Boltzmann function fitting to experimental data, as implemented in the Protein Thermal Shift Software (Applied Biosystems). Protein in 0.1% DMSO was used as a reference. Compounds that caused a shift in melting temperature of the protein (ΔT_m) of 2 °C or higher compared to the reference were considered positive hits.