Qiaamp viral rna extraction protocol

Complementary DNAs (cDNAs) were prepared according to Briese et al. (48 (link)). Briefly, RNA was extracted from hamster swabs and tissues following the QiaAmp Viral RNA extraction protocol (Qiagen), and 11 μl was taken into the SuperScript IV First-Strand cDNA synthesis system (Thermo Fisher Scientific) following the manufacturer’s instructions. After ribonuclease H treatment, second-strand synthesis was performed using Klenow fragment (New England Biolabs) following the manufacturer’s instructions. The resulting double-stranded cDNAs (ds-cDNA) were then purified using Ampure XP bead purification (Beckman Coulter) and eluted into 30 μl of water.

HIV-1 serology was determined by HIV Rapid Test Algorithm [54 ] in Tanzania or Alere Determine HIV-1/2 Ag/Ab Combo test in Zambia. The results were further verified in our lab at Lincoln, Nebraska using HIV-1-2.0 First Response kit (Premier Medical Corporation Limited, Daman, India). To quantify HIV-1 plasma viral load, viral RNA was extracted from the plasma according to the QIAamp viral RNA extraction protocol (Qiagen, Hilden, Germany). Viral copy numbers were determined using RNA Ultra-Sense One-Step quantitative RT-PCR system (Applied Biosystems, Carlsbad, CA) as previously described [55 (link)] with universal HIV LTR primers (forward [5’-GCCTCAATAAAGCTTGCCTTGA-3’] and reverse [5’–GGGCGCCACTGCTAGAGA–3’] and probe [5’-FAM/CCAGAGTCACACAACAGACGGGCACA/-BHQ1-3’]) under the following cycling conditions: 50°C for 15 min, 95°C for 2 min, 40 cycles of 95°C for 15 seconds, and 60°C for 30 seconds.

HIV-1 serology was determined by point-of-care serology and plasma viral load by quantitative RT-PCR as previously described [5 (link)]. Briefly, HIV-1 screening was done using HIV Rapid Test Algorithm in Tanzania or Alere Determine HIV-1/2 Ag/Ab Combo test in Zambia [53 ]. Viral RNA was extracted from plasma according to the QIAamp viral RNA extraction protocol (Qiagen, Hilden, Germany). The viral copy numbers were then determined using RNA Ultra-Sense One-Step quantitative RT-PCR system (Applied Biosystems, Carlsbad, CA) as previously described with universal HIV LTR primers [54 (link)] (forward [5′-GCCTCAATAAAGCTTGCCTTGA-3′] and reverse [5′–GGGCGCCACTGCTAGAGA–3′] and probe [5′-FAM/CCAGAGTCACACAACAGACGGGCACA/-BHQ1-3′]) under the following conditions: 50°C for 15 min, 95°C for 2 min, 40 cycles of 95°C for 15 seconds, and 60°C for 30 seconds.