Pgl3 basic vector

The human ACTN4 promoter luciferase reporter gene vector was constructed, the full-length promoter of ACTN4 carrying mutant or wild type was respectively cloned into pGL3-basic vectors (GeneCreate, Wuhan, China), and co-transfected with USF2 overexpression vector or mock vector into 293 T cells. The cells were harvested after 48 h, the Dual Luciferase Reporter Assay System Kit (Promega, Madison, WI, USA) was used to detect the activities of firefly and Renilla luciferase.

The RNAhybrid database predicted the binding sequences of mir-486-3p and Sirt6. Sirt6 3'UTR containing wild-type (WT) or mutant (Mut) binding site of human mir-486-3p were designed and synthesized by GenePharma (Shanghai, China). 293 T were co-transfected with the corresponding plasmids and human mir-486-3p mimics/mimics-NC or inhibitors/inhibitors-NC with Lipofectamine 2000 (Invitrogen). To construct of luciferase reporter gene vector containing Sirt6 promotor, the full-length Sirt6 promotor containing wild or mutant type was respectively cloned into pGL3-basic vectors (Genecreate, Wuhan, China), and co-transfected with or without Sirt6 overexpression vector. After 48 h of incubation, the activities of firefly and Renilla luciferase were measured using the Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, USA). The binding sequences of miRNA and target gene were shown as follows, hsa-miR-486-3p: CGGGGCAGCTCA GTACAGGAT; Sirt6-WT: CTGTGCTCCAGGCCAGGGGTTACACCTGCCCT; Sirt6-MT: TCACATCCCAGGCCAGAAATTA CACTCATTTC.

The sequences of circSEPT9 or LIF 3’UTR containing the wild-type (WT) or mutant (Mut) binding site of hsa-miR-637 were devised and synthesized by GenePharma (Shanghai, China). 293 T or 293 cells were co-transfected with the corresponding plasmids and hsa-miR-637 mimics/miR-NC or hsa-miR-637 inhibitors/inh-NC with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). To construct of a luciferase reporter gene vector containing SEPT9 promoter, the full-length SEPT9 promoter containing wide or mutant type was respectively cloned into pGL3-basic vectors (Genecreate, Wuhan, China), and co-transfected with or without E2F1 overexpression vector later. After 48 h of incubation, the activities of firefly and Renilla luciferase were measured using the Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, USA).