Rnadvance viral xp kit

Manufactured by Beckman Coulter

Sourced in United States

The RNAdvance Viral XP kit is a nucleic acid extraction and purification solution designed for the efficient isolation of viral RNA from a variety of sample types. The kit utilizes magnetic bead-based technology to provide reliable and consistent results.

Automatically generated - may contain errors

Lab products found in correlation

Proteinase k, by NZYTech (1 mentions) Cfx384 real time pcr system, by Bio-Rad (1 mentions) Primer express software, by Thermo Fisher Scientific (1 mentions) Sensifast probe lo rox one step kit, by Meridian Bioscience (1 mentions) Biomek i7 automated workstation, by Beckman Coulter (1 mentions)

Spelling variants of this product

RNAdvance Viral Kit (7 citations)

3 protocols using rnadvance viral xp kit

Direct RT-PCR for SARS-CoV-2 Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

To compare paired SAL and NPS samples, total RNA was extracted from 200 μl of the NPS viral transport medium and saliva samples, using RNAdvance Viral XP kit (Beckman Coulter, Indianapolis, United States) using Biomek i5 Automated Workstation liquid handling (Beckman Coulter, Indianapolis, United States) according to manufacturer’s protocol.
To simplify procedures, reduce costs and time of analysis, we optimized a direct RT-PCR approach for SARS-Cov-2 detection combining Proteinase K and heat-inactivation. For this purpose, a volume of 100 μL of sample (single or pooled) was mixed with 20 μL of Proteinase K (20 μg/mL, NZYTech, Lisboa, Portugal) followed by incubation at 57°C (15 min) and at 95°C for 15 min (enzyme and viral inactivation). This strategy was used to determine sensitivity and reproducibility for pooling assays.

Esteves E., Mendes A.K., Barros M., Figueiredo C., Andrade J., Capelo J., Novais A., Rebelo C., Soares R., Nunes A., Ferreira A., Lemos J., Duarte A.S., Silva R.M., Inácio Bernardino L., Correia M.J., Esteves A.C, & Rosa N. (2022). Population wide testing pooling strategy for SARS-CoV-2 detection using saliva. PLoS ONE, 17(1), e0263033.

+ Open protocol

+ Expand

RT-qPCR Detection of HCoV-OC43 RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the RNAdvance Viral XP kit (Beckman Coulter) as per the manufacturer’s protocol. HCoV-OC43 RNA was analyzed by RT-qPCR using 10 µl reactions with a 2× One-Step RT-PCR Master Mix (Norgen Biotek), 2.5 µl of RNA extract and primer/probe sets for the membrane protein gene (For: ATGTTAGGCCGATAATTGAGGACTAT, 300 nM; Rev: AATGTAAAGATGGCCGCGTATT, 300 nM; Probe: Cy5-CATACTCTGACGGTCACAAT, 200 nM)^{48 (link)} or N gene (For: CGATGAGGCTATTCCGACTAGGT, 450 nM; Rev: CCTTCCTGAGCCTTCAATATAGTAACC, 450 nM; Probe: HEX-TCCGCCTGGCACGGTACTCCCT, 100 nM)^{49 (link)}. Samples were analyzed on a BioRad CFX384 real-time PCR system with the following settings: 50 °C for 30 min, 95 °C for 3 min, then 45 cycles of 95 °C for 3 s and 60 °C for 30 s, followed by fluorescence detection. To quantify viral copy number, standard curves were generated using SARS-CoV-2 or HCoV-OC43 synthetic RNA standards (Twist Biosci).

Pires L., Wilson B.C., Bremner R., Lang A., Larouche J., McDonald R., Pearson J.D., Trcka D., Wrana J., Wu J, & Whyne C.M. (2022). Translational feasibility and efficacy of nasal photodynamic disinfection of SARS-CoV-2. Scientific Reports, 12, 14438.

+ Open protocol

+ Expand

SARS-CoV-2 Viral RNA Detection in Nursing Homes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Negative and positive qRT-PCR nasopharyngeal-swab samples from symptomatic and asymptomatic individuals were collected as part of routine scanning of nursing homes. Ethical review and approval were waived, since the samples used for this study were leftovers of anonymized samples. No information is available on the level of symptoms manifested by each tested positive individual. Viral RNA was extracted using RNAdvance Viral XP kit (Beckman Coulter). From each sample 200 μL were added to LBF lysis buffer, and further processed on the Biomek i7 Automated Workstation (Beckman Coulter), according to the manufacturer's protocol. Each sample was eluted in 50 μL of RNase-free water. Real-time RT-PCR assays were performed using the SensiFASTTM Probe Lo-ROX one-step kit (Bioline). In each reaction the primers final concentration was 600 nM and the probe concentration was 300 nM. Thermal cycling was performed at 48°C for 20 minutes for reverse transcription, followed by 95°C for 2 min, and then 45 cycles of 94°C for 15 sec, 60°C for 35 sec. Primers and probes (listed in Supplementary Table S2) were designed using the Primer Express Software (Applied Biosystems) and purchased from Integrated DNA Technologies, Inc.

Israeli M., Finkel Y., Yahalom-Ronen Y., Paran N., Chitlaru T., Israeli O., Cohen-Gihon I., Aftalion M., Falach R., Elia U., Nemet I., Kliker L., Mandelboim M., Beth-Din A., Israely T., Cohen O., Stern‐Ginossar N., & Bercovich-Kinori A. (2021). CRISPR screens for host factors critical for infection by SARS-CoV-2 variants of concern identify GATA6 as a central modulator of ACE2.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!