Total RNA was extracted using TRIzol reagent (Sigma). Complementary DNA (cDNA) was reverse-transcribed by a Tiangen lnRcute lncRNA cDNA Synthesis Kit (Tiangen, China) and a Roche Reverse Transcription System (USA). qPCR was performed using lncRNA qPCR Detection Kit (Tiangen, China) and Fast SYBR Green qPCR Master Mix (Thermo Fisher, USA).
Lncrna qpcr detection kit
Manufactured by Tiangen Biotech
Sourced in China
The LncRNA qPCR Detection Kit is a laboratory equipment product designed for the detection and quantification of long non-coding RNA (lncRNA) molecules using quantitative real-time PCR (qPCR) technology. The kit provides the necessary reagents and protocols to perform lncRNA expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
Fast sybr green qpcr mastermix, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Lncrna cdna synthesis kit, by Tiangen Biotech (1 mentions)
7500 pcr system, by Thermo Fisher Scientific (1 mentions)
Trnzol universal reagent, by Tiangen Biotech (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Reverse transcription system, by Roche (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
4 protocols using lncrna qpcr detection kit
1
Comprehensive lncRNA Expression Analysis
2
SNHG5 Expression Profiling by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRNzol Universal reagent (Tiangen, Beijing, China). The A260/A280 ratio of purified RNA was typically between 1.8 and 2.4 and the yield between 80µg and 120µg. RNA samples were stored at -80°C. RNA integrity was assessed by gel electrophoresis.
RNA was reverse transcribed into cDNA with lncRNA cDNA Synthesis Kit (Tiangen, Beijing, China). LncRNA qPCR Detection Kit (Tiangen, Beijing, China) was applied to examine the expression of SNHG5 on a 7500 PCR System (Applied Biosystems, USA) in accordance with manufacturer's instructions. Each reaction contained 2×lnR lncRNA Premix (25 µl), 50×ROX Reference Dye (1 µl), Forward Primer (1.25 µl), Reverse Primer (1.25 µl), RNA template (2 µl) and RNase-Free ddH2O (19.5 µl). The cycling condition is as follows: Stage 1: 42°C for 20 min, 95°C for 3 min,1 Cycle; Stage 2: 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 40 Cycles; Stage 3: 72°C for 50 min. SNHG5's forward primer was 5'- CGCTTGGTTAAAACCTGACACT -3' and its reverse primer was 5'- CCAAGACAATCTGGCCTCTATC -3'. Relative expression level of SNHG5 was calculated using 2-ΔΔCT method after normalization with reference gene (GAPDH).
RNA was reverse transcribed into cDNA with lncRNA cDNA Synthesis Kit (Tiangen, Beijing, China). LncRNA qPCR Detection Kit (Tiangen, Beijing, China) was applied to examine the expression of SNHG5 on a 7500 PCR System (Applied Biosystems, USA) in accordance with manufacturer's instructions. Each reaction contained 2×lnR lncRNA Premix (25 µl), 50×ROX Reference Dye (1 µl), Forward Primer (1.25 µl), Reverse Primer (1.25 µl), RNA template (2 µl) and RNase-Free ddH2O (19.5 µl). The cycling condition is as follows: Stage 1: 42°C for 20 min, 95°C for 3 min,1 Cycle; Stage 2: 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 40 Cycles; Stage 3: 72°C for 50 min. SNHG5's forward primer was 5'- CGCTTGGTTAAAACCTGACACT -3' and its reverse primer was 5'- CCAAGACAATCTGGCCTCTATC -3'. Relative expression level of SNHG5 was calculated using 2-ΔΔCT method after normalization with reference gene (GAPDH).
3
Quantification of lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Thermo Fisher Scientific, USA) was used to extract RNA from cells, after which a lncRNA First-Strand cDNA Synthesis Kit (Tiangen, China) was used for cDNA preparation. A lncRNA qPCR Detection Kit (Tiangen, China) was then used based on provided directions with the following primers: CEBPA-DT: 5'-GCTTCGTTTTCGGTCCAGA-3' (sense) and 5'-CCCTCCACAGGTGAATGCTAT-3' (antisense); CEBPA: 5'-TTTGCTCGGATACTTGCCA-3' (sense) and 5'-AAAGGAAAGGGAGTCTCAGACC-3' (antisense); BCL2: 5'- GATTGAAGACACCCCCTCGT-3' (sense) and 5'-CCGGTTATCGTACCCTGTTCT-3' (antisense); GAPDH: 5'-GGGAGCCAAAAGGGTCAT-3' (sense) and 5'- GAGTCCTTCCACGATACCAA -3' (antisense) 12 (link). CEBPA-DT relative expression was assessed via the 2-ΔΔCT method, with GAPDH being used for normalization.
4
Quantitative Analysis of RNA Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and exosomes using TRIzol reagent (Ambion, USA) in accordance with the manufacturer’s instructions. Then, 1 µg RNA was reverse transcribed into cDNA by a Reverse Transcription System (Roche, USA). NCBI Primer BLAST (www.ncbi.NLM.NIH.Gov/tools/primerblast/ ) and Primer bank (https://pga.mgh.harvard.edu/primerbank/ ) were used to design primers. RT-qPCR analysis was carried out using a lncRNA qPCR Detection Kit (Tiangen, China) and Fast SYBR Green Master Mix (Thermo Fisher). β-Actin were used as an internal reference. Relative mRNA levels were calculated by the 2−ΔΔCT method. Details of RNA primers are shown in Table 1 .
Primer sequences for quantitative real-time polymerase chain reaction
| Gene | Forward (5’ -> 3’) | Reverse (5’ -> 3’) |
|---|---|---|
| Collagen IV | CTGGCACAAAAGGGACGAG | ACGTGGCCGAGAATTTCACC |
| α-SMA | GTCCCAGACATCAGGGAGTAA | TCGGATACTTCAGCGTCAGGA |
| E-cadherin | CAGGTCTCCTCATGGCTTTGC | CTTCCGAAAAGAAGGCTGTCC |
| fibronectin | GCTCAGCAAATCGTGCAGC | CTAGGTAGGTCCGTTCCCACT |
| ENSMUST00000181751.1 | AGCTACACCTTCTTCTTGGACTG | ACCAAGCTGTACCAGAGTGC |
| XR_001778608.1 | TTTTCAGCTAGAGCACCCCC | ATGAGAAGGGCAGTCTGGGA |
| XR_880236.2 | GTCTGATGGGGTCAGTGCAT | TTGGGGACTGTGTAATCGGG |
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Abbreviation: α-SMA:α-smooth muscle actin
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!