Green fluorescent protein (GFP) and a puromycin resistance gene were carried by lentiviral vectors that were used for CDX2 overexpression and knockdown, respectively. In the presence of a multiplicity of infection (MOI) of 10 and at a concentration of 10 g/ml polybrene, cells were transduced with the appropriate lentiviral vector encoding the gene of interest (Sigma-Aldrich, St. Louis, MO, USA). In addition, in order to control for the effects of viral vector transduction, each cell line was transduced with a nontargeting negative control lentiviral vector using the same method. After incubation for 12 hours at 37 degrees Celsius, the medium was changed out for a fresh batch of the suitable media. After incubation for forty-eight hours, a concentration of two micrograms per milliliter of puromycin (Sigma-Aldrich) was applied in order to select for stably transduced cell lines. Evaluation of transduction efficiency was performed 72 hours after transduction by counting GFP positive cells using a fluorescence microscope.
Lentiviral vector
Manufactured by Merck Group
Sourced in United States
Lentiviral vector is a type of viral vector that is used for gene delivery and gene expression in cells. It is derived from the lentivirus family, which includes the human immunodeficiency virus (HIV). The lentiviral vector is engineered to be replication-deficient, making it a safe and efficient tool for gene transfer in research and clinical applications.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Merck Group (3 mentions)
Mission shrna library, by Merck Group (2 mentions)
Polybrene, by Merck Group (2 mentions)
Psicor pgk puro, by Addgene (1 mentions)
Plko 1 puro, by Merck Group (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Plko 1 puro vector, by Addgene (1 mentions)
Recombinant lentiviruses, by OriGene (1 mentions)
H9c2 rat cardiomyoblast cell line, by American Type Culture Collection (1 mentions)
9 protocols using lentiviral vector
1
Lentiviral Transduction for Genetic Manipulation
2
Lentiviral Knockdown of Oncogenes in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The short hairpin RNA (shRNA) specifically against BRAF and the scramble control shRNA were cloned into the lentiviral vector pSicoR-PGK-puro (#12084, Addgene, Cambridge, MA)52 (link). A pLKO.1-puro based lentiviral vector expressing shRNA against TERT (#TRCN0000240466), FOS (#TRCN0000016007) and MYC (#TRCN0000039642) were purchased from Sigma-Aldrich and the pLKO.1-puro vector with scramble shRNA was purchased from Addgene (plasmid #1864). To generate lentiviral particles, the lentiviral shRNA-expressing vector with the packaging plasmid PSPAX2 and the VSV-G envelope protein-coding plasmid pMD2.G were co-transfected to HEK293T cells using Lipofectamine 3000 (Invitrogen) and the supernatant was harvested 48 h after transfection. To generate cell lines with stable knockdown of BRAF, TERT, FOS or MYC, cancer cells were exposed to the above lentivirus-containing supernatant for 24 h in the presence of 8 μg ml−1 polybrene (Millipore, Billerica, MA) and selected by 2 μg ml−1 puromycin (Sigma-Aldrich) for 2 weeks. The stable transfection cell pools were confirmed by western blotting analysis of the proteins of interest.
3
CLIC1 and CLIC4 Knockdown in HUVEC
4
Osteoblast Differentiation with TAOK3 Silencing
5
Lentiviral Overexpression of LGALS1 in Gastric Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A lentiviral vector for LGALS1 overexpression and a corresponding non-targeting negative control lentiviral vector were constructed by Genechem Co., Ltd. (Shanghai, China). The GV358 (Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin) lentiviral vector was constructed to upregulate LGALS1 expression. SGC-7901 and HGC-27 cells were seeded at a concentration of 5 × 104 cells per well in six-well plates before lentiviral transduction. The cells were transduced with lentiviral vector and 10 μg/mL of polybrene (Sigma-Aldrich, St. Louis, MO, USA) based on an infection multiplicity of 10. The corresponding non-targeting negative control lentiviral vector was transduced through the same approach. The medium was replaced 12 h after transduction and puromycin (Sigma-Aldrich) was added to select stable transduced cell lines at the concentration of 2 μg/mL after another 48 h. The stable transduced cells were then cultured in the presence of 0.5 μg/mL of puromycin. Fluorescent microscopy (OLYMPUS-U-HGLGPS-IX73), qualitative reverse-transcriptase polymerase chain reaction (qRT-PCR), and Western blotting were used to evaluate transduction efficiency after 72 h.
6
Lentiviral RNAi Knockdown of PKCι and YAP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral vector containing RNAi sequence against human PKCι (Target Sequence: GCCTGGATACAATTAACCATT) and YAP1 (Target Sequence: CCCAGTTAAATGTTCACCAAT) were obtained from the Sigma-Aldrich Mission shRNA library and packaged into lentiviruses as described previously.39 (link) A Lentiviral vector containing a short hairpin RNAi (shRNA) which recognizes no human genes was used as a non-target control (NT-RNAi). RNAi infections were performed as described previously.39 (link) PKCι and YAP1 shRNA constructs were validated for specificity and efficiency as described previously.39 (link) Transduced cells were cultured in media containing 5 mg/ml of puromycin to select of stably transduced cell populations as described previously.39 (link) PKCι and YAP1 expression was determined by immunoblot analysis as described previously.10 (link)
7
Lentiviral CXCR4 Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral vector that carries CXCR4 shRNA or non-targeting (NT) shRNA was obtained from Sigma-Aldrich; Merck KGaA with the knockdown specificity and efficiency authenticated by the company. The CXCR4-shRNA base sequence was 5′-GGA TCA GCA TCG ATT CCT TCA-3′ and the NT-shRNA base sequence was 5′-TTC TCC GAA CGT GTC ACG T-3′. The vectors were packaged following the manufacturers' instructions. The multiplicity of infection was 2 for application on H9C2 cells, and the transduced cells were selected in puromycin for 10 days before evaluation for CXCR4 expression and myocyte functions.
8
GRK5 manipulation in H9c2 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The H9c2 rat cardiomyoblast cell line was purchased from American Type Culture Collection (Manassas, VA, United States) and cultured as previously described[11 ,16 -18 (link)]. Recombinant lentiviruses encoding for wild-type full-length GRK5 or for empty vector (control) (OriGene Technologies, Rockville, MD, United States) were propagated and purified via CsCl density gradient ultracentrifugation, as described previously[11 ,19 ]. For CRISPR/Cas9-mediated GRK5 gene deletion, a gRNA sequence was custom-synthesized by Sigma-Aldrich (target ID: RN0000391809, target sequence: 5’-GTGGTTTGAATTTATGCGG-3’) and incorporated into a lentiviral vector (Sigma-Aldrich). Along with negative control CRISPR lentiviral particles (CNCV, Cat #CRISPR12V-1EA, Sigma-Aldrich), this lentivirus was also propagated and purified through cesium chloride density gradient ultracentrifugation.
9
Lentiviral RNAi Knockdown of PKCι and YAP1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!