Genomic DNA was extracted from white blood cells using the salting out method [20 ].
The concentration of extracted DNA was measured using Nanodrop spectrophotometer (ND-1000, ThermoFisher Scientific, Wilmington, USA). It was then frozen at − 70 °C to be used for subsequent experiments. Genotypes of CD36-rs1761667 polymorphism were determined using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method as described below.
The SNP was detected by PCR using following primers: 5′- CAAGGTCTGGTATCCACCTGTT − 3′ (forward), 5′- ATGAAGCTTCCCGCCTTAGAA − 3′ (reverse) and amplification was carried out using a Biometra T advanced (Analytik Jena, Germany). PCR conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of amplification including denaturation at 95 °C, annealing at 60 °C, extension at 72 °C (each comprising 30 s), and the final extension at 72 °C for 5 min. PCR products (10 μl) were digested with HhaI restriction endonuclease (Thermo Scientific, USA) at 37 °C for 16 h and fragments were separated by agarose gel electrophoresis (1.5% agarose) stained with ethidium bromide. Afterwards, being observed by ultraviolet light (UV Tec Cambridge Gel doc), three genotypes of CD36-rs1761667 were detected which include: GG (161 and 264 bp), GA (161, 245, and 425 bp), and AA (425 bp).
The concentration of extracted DNA was measured using Nanodrop spectrophotometer (ND-1000, ThermoFisher Scientific, Wilmington, USA). It was then frozen at − 70 °C to be used for subsequent experiments. Genotypes of CD36-rs1761667 polymorphism were determined using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method as described below.
The SNP was detected by PCR using following primers: 5′- CAAGGTCTGGTATCCACCTGTT − 3′ (forward), 5′- ATGAAGCTTCCCGCCTTAGAA − 3′ (reverse) and amplification was carried out using a Biometra T advanced (Analytik Jena, Germany). PCR conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of amplification including denaturation at 95 °C, annealing at 60 °C, extension at 72 °C (each comprising 30 s), and the final extension at 72 °C for 5 min. PCR products (10 μl) were digested with HhaI restriction endonuclease (Thermo Scientific, USA) at 37 °C for 16 h and fragments were separated by agarose gel electrophoresis (1.5% agarose) stained with ethidium bromide. Afterwards, being observed by ultraviolet light (UV Tec Cambridge Gel doc), three genotypes of CD36-rs1761667 were detected which include: GG (161 and 264 bp), GA (161, 245, and 425 bp), and AA (425 bp).