Jetprime in vitro sirna transfection reagent

Small interfering RNAs (siRNAs) against BTF3 (siBTF3#1: GCCGAAGAAGCCUGGGAAUCA; siBTF3#2: GCAGGCACAAGUGCGCAUUTT), STAT3 (siSTAT3#1: GUUGAAUUAUCAGCUUAAA; siSTAT3#2: CAUCUGCCUAGAUCGGCUA), NLRP3 (siNLRP3: CAACAGGAGAGACCUUUAU) and small interfering negative control (siNC) were constructed by GenePharma Technologies. Smart silencer of LINC01128 was purchased from RIBOBIO, and the overexpression (OE) plasmid of LINC01128 (OE‐LINC01128) was purchased from GeneKai. Cells were transfected at 50% confluency using jetPRIME in vitro siRNA transfection reagent (#114‐01, Polyplus).
ARID5B shRNA (shARID5B#1: GCCTTCAAAGAGAACCATTTA; shARID5B#2: CTACACCTGTAGGAAGTTCAT), scrambled negative control (shNC), OE‐ARID5B, OE‐STAT3 and negative control (OE‐NC) lentiviruses were constructed by GeneKai. After infecting with lentiviruses, cells were selected using puromycin (3 μg/mL). For co‐transfection, transfecting THP‐1 cells with the LINC01128 overexpression plasmid for 24 h, then performing a 48 h of infection with ARID5B shRNA or BTF3 siRNA.

HCT116^wt, DLD-1 and SW480 cells were seeded in 6-well plates 1 day for transfection at a density of 3 × 10⁶ cells/well. Mixture containing 110 pmoles of Noxa siRNA (sc-37305, Santa Cruz Biotechnology) or control siRNA (sc-36869, Santa Cruz Biotechnology), 200 μl of jetPRIME^® buffer (Polyplus-Transfection, Illkich, Franc) and 4 μl of jetPRIME^®in vitro siRNA transfection reagent (Polyplus-Transfection) was vortexed 10 seconds, spun down and incubated 10 minutes at room temperature. This transfection mixture was added to each well. After incubated for 24 hours, cells were harvested for further analysis.