Gel loading dye 2, by Thermo Fisher Scientific - Product details

1

Nascent Strand Analysis Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nascent strand analysis was performed as previously described (Räschle et al., 2008 (link)). Briefly, purified DNA was digested with the indicated restriction enzymes followed by addition of 0.5 volumes of Gel Loading Dye II (Denaturing PAGE) (Life Technologies). DNA fragments were subsequently separated on 5% or 7% denaturing polyacrylamide gels, transferred to filter paper, dried, and visualized using a phosphorimager. Radioactive signal was quantified using ImageJ (NIH, USA).
Reference oligo used in Figure S4I: 5′-CATTCAGCTCCCGGAGACGGTCACAGCTTG TCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGGCTGAGGTACCG-3′.
Primer used for dideoxy-sequencing ladder in Figure S4I: 5′- CAT TCA GCT CCC GGA GAC GGT C – 3′.

Larsen N.B., Gao A.O., Sparks J.L., Gallina I., Wu R.A., Mann M., Räschle M., Walter J.C, & Duxin J.P. (2019). Replication-Coupled DNA-Protein Crosslink Repair by SPRTN and the Proteasome in Xenopus Egg Extracts. Molecular Cell, 73(3), 574-588.e7.

+ Open protocol

+ Expand

2

Nascent Strand Analysis of DNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nascent strand analysis was performed as previously described (Räschle et al., 2008 (link)). Briefly, purified DNA was digested with the indicated restriction enzymes followed by addition of 0.5 volumes of Gel Loading Dye II (Denaturing PAGE) (Life Technologies, Grand Island, NY, USA). DNA fragments were subsequently separated on 5% or 7% denaturing polyacrylamide gels, transferred to filter paper, dried, and visualized using a phosphorimager. The sequencing ladders were generated with the indicated primers using Cycle Sequencing kit (USB Corporation, Cleveland, OH, USA). Radioactive signal was quantified using ImageJ (NIH, USA).
Primer N: 5′-CATGGGGCGGAGAATGGG-3′;
Primer A: 5′-CTAAGAAACCATTATTATCATGACATTAACC-3′.

Duxin J.P., Dewar J.M., Yardimci H, & Walter J.C. (2014). Repair of a DNA-protein crosslink by replication-coupled proteolysis. Cell, 159(2), 346-357.

+ Open protocol

+ Expand

3

Intron Retrohoming Reverse Splicing Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA oligonucleotides (IDT3204 - CAACCCCGTCGTCGTGAACACATCCA TAACCATATCATTTTTAATTCTAC, and IDT3206 - GTAGAATTAAAAATGATATG GTTATGGATGTGTTCACGATCGACGTGGGTTG), which contain all the sequence required for intron retrohoming, were labeled at the 5’ end using ³²P-γ-ATP (PerkinElmer) and T4 polynucleotide kinase (NEB), and annealed to make a double-stranded substrate. To assay activity, 100 ng of purified intron RNP was incubated in reverse splicing buffer (50 mM Tris-HCl, pH7.5, 10 mM KCl, 10 mM MgCl₂, 5 mM DTT, 0.1% Nonidet P-40, 0.1% Tween-20) at 37 °C for 50 min, with 0.4 pmol of ³²P-end-labeled substrate DNA. Reaction products were put on ice, divided in half, and diluted with glycerol (25%, v/v) (for native gel) or 2X Gel Loading Dye II (Ambion) (for denaturing gel). Products were analyzed for DNA binding and reverse splicing, on a 4% native polyacrylamide gel and a denaturing 7 M urea-10% polyacrylamide, respectively, exposed on phosphor screens, and scanned on a GE Healthcare Typhoon Trio. Original images of gels, autoradiographs and blots used in this study can be found in Supplementary Data Set 1.

Qu G., Kaushal P.S., Wang J., Shigematsu H., Piazza C.L., Agrawal R.K., Belfort M, & Wang H.W. (2016). Structure of a Group II Intron Complexed with its Reverse Transcriptase. Nature structural & molecular biology, 23(6), 549-557.

+ Open protocol

+ Expand

4

Synthetic RNA Cleavage by MazF-SEA

Check if the same lab product or an alternative is used in the 5 most similar protocols

As the substrate, 0.45 pmol of the synthetic RNA (2000–1) was incubated with 0.05 pmol of MazF-SEA at 37 ºC for 10 min in 30 μl of MazF reaction buffer (40 mM Tris-HCl (pH 8.0), 1 mM dithiothreitol, 0.01% Triton X-100, and 4 U Recombinant RNase inhibitor (Takara)). In addition, 0.05, 0.5, and 5.0 pmol of MazE-SEA were incubated with 0.05 pmol of MazF-SEA at 25 ºC for 10 min and incubated with 0.45 pmol of the synthetic RNA (2000–1). Incubated RNA was purified using RNA Clean and Concentrator-5 (Zymo Research) and then incubated at 95 ºC for 5 min with gel-loading dye II (Ambion). The denatured RNA was separated on a 10% polyacrylamide gel containing 7 M urea. The RNA was stained with SYBR Gold (Life Technologies) and detected using a Typhoon 9210 imager (Cytiva).

Okabe T., Aoi R., Yokota A., Tamiya-Ishitsuka H., Jiang Y., Sasaki A., Tsuneda S, & Noda N. (2024). Arg-73 of the RNA endonuclease MazF in Salmonella enterica subsp. arizonae contributes to guanine and uracil recognition in the cleavage sequence. The Journal of Biological Chemistry, 300(2), 105636.

+ Open protocol

+ Expand

5

Intron Retrohoming Reverse Splicing Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA oligonucleotides (IDT3204 - CAACCCCGTCGTCGTGAACACATCCA TAACCATATCATTTTTAATTCTAC, and IDT3206 - GTAGAATTAAAAATGATATG GTTATGGATGTGTTCACGATCGACGTGGGTTG), which contain all the sequence required for intron retrohoming, were labeled at the 5’ end using ³²P-γ-ATP (PerkinElmer) and T4 polynucleotide kinase (NEB), and annealed to make a double-stranded substrate. To assay activity, 100 ng of purified intron RNP was incubated in reverse splicing buffer (50 mM Tris-HCl, pH7.5, 10 mM KCl, 10 mM MgCl₂, 5 mM DTT, 0.1% Nonidet P-40, 0.1% Tween-20) at 37 °C for 50 min, with 0.4 pmol of ³²P-end-labeled substrate DNA. Reaction products were put on ice, divided in half, and diluted with glycerol (25%, v/v) (for native gel) or 2X Gel Loading Dye II (Ambion) (for denaturing gel). Products were analyzed for DNA binding and reverse splicing, on a 4% native polyacrylamide gel and a denaturing 7 M urea-10% polyacrylamide, respectively, exposed on phosphor screens, and scanned on a GE Healthcare Typhoon Trio. Original images of gels, autoradiographs and blots used in this study can be found in Supplementary Data Set 1.

Qu G., Kaushal P.S., Wang J., Shigematsu H., Piazza C.L., Agrawal R.K., Belfort M, & Wang H.W. (2016). Structure of a Group II Intron Complexed with its Reverse Transcriptase. Nature structural & molecular biology, 23(6), 549-557.

+ Open protocol

+ Expand

Gel loading dye 2

Lab products found in correlation

Spelling variants of this product

5 protocols using gel loading dye 2

Nascent Strand Analysis Protocol

Nascent Strand Analysis of DNA

Intron Retrohoming Reverse Splicing Assay

Synthetic RNA Cleavage by MazF-SEA

Intron Retrohoming Reverse Splicing Assay

About PubCompare

Ready to get started?