The largest database of trusted experimental protocols

Lzrs ires gfp

Manufactured by Addgene

The LZRS-IRES-GFP is a retroviral vector that allows for the expression of a gene of interest and Green Fluorescent Protein (GFP) from a single transcript. It contains an Internal Ribosome Entry Site (IRES) sequence that enables the translation of two open reading frames from the same mRNA. This vector can be used for the stable transduction of mammalian cells and the identification of successfully transduced cells through the expression of GFP.

Automatically generated - may contain errors

2 protocols using lzrs ires gfp

1

Generating Genetically Modified Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MYD88 coding sequence was subcloned into LZRS-IRES-GFP (Addgene plasmid #21961). Subsequently, the QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, California, USA) was utilized to generate the MYD88 mutant constructs according to the manufacturer’s instructions. Mutants were confirmed by Sanger sequencing. To generate doxycycline-inducible MYD88 knockdown cell lines, we inserted an shRNA targeting MYD88 (GCAGAGCAAGGAATGTGACTT or GACCCAATGTACCAGTATT) into Tet-pLKO-puro (Addgene plasmid #21915). To generate MYD88 knockout cells, we inserted a single guide RNA targeting MYD88 (CTGCTCTCAACATGCGAGTG or CTCGAGCAGTCGGCCTACAG) into pL-CRISPR.EFS.GFP (Addgene plasmid #57818). For generation of stable Cas9 expressing cell lines, we used lentiCas9-Blast (Addgene plasmid #52962). MSCV-CA-IKK2-IRES-GFP was kindly provided by Dr J. Schuringa (University of Groningen, Groningen, The Netherlands).
+ Open protocol
+ Expand
2

Stable Transfection of NEDD9 in Colon Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid LZRS/IresGFP, LZRS/IresGFP-hNEDD9, pLKO, pLKO/shC, and pLKO/shD were from Addgene (Cambridge, MA). DLD1 and SW480 cells were transfected with 4 μg plasmid using Lipofectamine. Cells that stably expressing or knockdown NEDD9 were selected using 10 μg/mL puromycin for 2 weeks followed by immunoblotting analysis to verify NEDD9 expression.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!