After H/R induction, H9c2 cells were collected for RT-qPCR analysis. Total RNA was extracted with TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and its concentration was measured at a wavelength of 260 nm by spectrophotometry. In accordance with their respective manufacturer's protocols, a high-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Inc.) and SYBR™ Green quantitative kit (Thermo Fisher Scientific, Inc.) were used to reverse transcribe RNA into cDNA and for qPCR analysis, respectively, and GAPDH was used as the internal reference. The primers used in the present study were as follows: APPL1 forward, 5'-GCCCGCAGACAAGGTCTTTA-3' and reverse, 5'-TGAGGTCAGGTGTGTTGCTG-3'; TNF-α forward, 5'-TGAGCACAGAAAGCATGATC-3' and reverse, 5'-CATCTGCTGGTACCACCAGTT-3'; monocyte chemoattractant protein 1 (MCP-1) forward, 5'-TCCACCACTATGCAGGTCTC-3' and reverse, 5'-TGGACCCATTCCTTATTGGG-3'; IL-1β, forward, 5'-GACCTGTTCTTTGAGGCTGAC-3', and reverse, 5'-TCCATCTTCTTCTTTGGGTATTGTT-3'; and GAPDH forward, 5'-AGGGGCCATCCACAGTCTTC-3' and reverse, 5'-CAGTGCCAGCCTCGTCTCAT-3'. The qPCR thermocycling conditions were as follows: Initial denaturation at 94˚C for 3 min; followed by 34 cycles of annealing at 55˚C for 45 sec and extension at 72˚C for 2 min; and a final extension at 72˚C for 7 min. The results of the experiments were analyzed using the 2-ΔΔCq method (22 (link)).
Sybr green quantitative kit
Manufactured by Thermo Fisher Scientific
Sourced in Japan, China
The SYBR Green quantitative kit is a molecular biology tool used for the detection and quantification of DNA or RNA targets in real-time PCR experiments. The kit contains SYBR Green I, a fluorescent dye that binds to double-stranded DNA, allowing for the monitoring of amplification during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Superscript 3 reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit with genomic dna eraser, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
5 protocols using sybr green quantitative kit
1
RT-qPCR Analysis of H9c2 Cell Transcripts
2
Quantitative Analysis of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After H/R induction, HL-1 cells were collected for RT-qPCR. The total RNA was obtained by TRIzol treatment and its purity was determined with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific) to measure the absorption ratio at 280 nm and 260 nm. The reverse transcription of RNA into the complementary DNA and qPCR was conducted with application of a PrimeScript™ RT reagent kit with genomic DNA eraser (RR047A, Takara, Tokyo, Japan) and a SYBR™ Green quantitative kit (Thermo Fisher Scientific). With U6 serving as the internal reference of miR-146a-5p [28 (link)] and glyceraldehyde-3-phosphate dehydrogenase 9 (GAPDH) serving as the internal reference of mRNA, the relative gene expression was quantified based on the 2-ΔΔCt method [39 (link)]. Information on primers is shown in Table 1 .
PCR primer sequences
| Gene | Sequence (5’-3’) |
|---|---|
| METTL14 | F: GCACAGACGGGGACTTCATT |
| R: TCCCAAAGAGATGAAGGCGT | |
| miR-146a-5p | F: GCGGTCGTGAGAACTGAATTC |
| R: GTGTCGTGGAGTCGGCAATT | |
| pri-miR-146a-5p | F: CAGGTATCACTGGGGAACGG |
| R: TCTTCACGTCAGCAAGAGCA | |
| APPL1 | F: GAAAAACAGCGTTTTCCTTTG |
| R: TGCATGACAAGAACTAAGCTC | |
| U6 | F: GCTCGCTTCGGCAGCACATATA |
| R: GGAACGCTTCACGAATTTGCG | |
| GAPDH | F: GGTCCCAGCTTAGGTTCATCA |
| R: AATCCGTTCACACCGACCTT |
3
Real-Time qPCR Analysis of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues by TRIZOL (Invitrogen). Complementary DNA was reversed from 500 ng RNA by using the Superscript III Reverse Transcription kit (Invitrogen), and real‐time quantitative PCR analysis was performed using SYBR Green quantitative kit (Applied Biosystems). The primer sequence for real‐time PCR was listed: Fabp2: F‐5′‐TAAAGTAGCCCCAACCACGA‐3′; R‐5′‐GGAACCACAGGTCTTCCAAA‐3′, Tnf‐α: F‐5′‐ACGGCATGGATCTCAAAGAC‐3′; R‐5′‐AGATAGCAAATCGGCTGACG‐3′, Il‐1β: F‐5′‐CTGGTGTGTGACGTTCCCATTA‐3′; R‐5′‐CCGACAGCACGAGGCTTT‐3′, Mcp‐1: F‐5′‐CCACTCACCTGCTGCTACTCA‐3′; R‐5′‐TGGTGATCCTCTTGTAGCTCTCC‐3′, Vcam‐1: F‐5′‐CCGGCATATACGAGTGTGAA‐3′; R‐5′‐TAGAGTGCAAGGAGTTCGGG‐3′, Icam‐1: F‐5′‐TTCACACTGAATGCCAGCTC‐3′; R‐5′‐GTCTGCTGAGACCCCTCTTG‐3′, Zo‐1: F‐5′‐CAACATACAGTGACGCTTCACA‐3′; R‐5′‐CACTATTGACGTTTCCCCACTC‐3′, Occludin: F‐5′‐TGAAAGTCCACCTCCTTACAGA‐3′; R‐5′‐CCGGATAAAAAGAGTACGCTGG‐3′ and Gapdh: F‐5′‐AGGAGCGAGACCCCACTAAC‐3′; R‐5′‐GATGACCCTTTTGGCTCCAC‐3′. Gene expression was calculated by normalizing to Gapdh level.
4
Quantitative RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Kidney tissues or endothelial cells were homogenized in TRIzol (Invitrogen) for RNA extraction. Reverse transcription was carried out using the Superscript III Reverse Transcription kit (Invitrogen), and quantitative PCR analysis was performed using SYBR Green quantitative kit (Applied Biosystems, CA). The primer sequence of detected mRNA was listed as following: Klf4: F‐5′‐GTCAAGTTCCCAGCAAGTCAG‐3′; R‐5′‐CATCCAGTATCAGACCCCATC‐3′, TNF‐α: F‐5′‐ACGGCATGGATCTCAAAGAC‐3′; R‐5′‐AGATAGCAAATCGGCTGACG‐3′, IL‐6: F‐5′‐GTCCTTCCTACCCCAATTTCCA‐3′; R‐5′‐TAACGCACTAGGTTTGCCGA‐3′, iNOS: F‐5′‐CCAAGCCCTCACCTACTTCC‐3′; R‐5′‐CTCTGAGGGCTGACACAAGG‐3′, Cox‐2: F‐5′‐AACCGTGGGGAATGTATGAG‐3′; R‐5′‐GCAGGAAGGGGATGTTGTT′, GAPDH: F‐5′‐AGGAGCGAGACCCCACTAAC‐3′; R‐5′‐GATGACCCTTTTGGCTCCAC‐3′. Relative gene levels were normalized to GAPDH level.
5
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the whole aorta or intestine tissues was extracted by using TRIzol (Invitrogen), according to the manufacturer’s instructions. Complementary DNA was reverse-transcribed using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara Biotech, Dalian, China), and qPCR was performed with the SYBR Green quantitative kit (Applied Biosystems, CA). The primer sequences used in this study were listed as follows: mouse Zo-1: F-5′-CAACATACAGTGACGCTTCACA-3’; R-5′- CACTATTGACGTTTCCCCACTC-3′, mouse Tnf-α: F-5′-ACGGCATGGATCTCAAAGAC-3’ R-5′-AGATAGCAAATCGGCTGACG-3′, mouse Il-1β: F-5′-CTGGTGTGTGACGTTCCCATTA-3’; R-5′-CCGACAGCACGAGGCTTT-3′, mouse Il-6: F-5′-CCACGGCCTTCCCTAC-3’; R-5′- AAGTGCATCATCGTTGT-3′, mouse Mcp-1: F-5′-CCACTCACCTGCTGCTACTCA-3’; R-5′-TGGTGATCCTCTTGTAGCTCTCC-3′, mouse Vcam-1: F-5′-CCGGCATATACGAGTGTGAA-3’; R-5′-TAGAGTGCAAGGAGTTCGGG-3′, and mouse Gapdh: F-5′-AGGAGCGAGACCCCACTAAC-3’; R-5′-GATGACCCTTTTGGCTCCAC-3’. The relative gene expression was calculated by normalizing to the Gapdh level.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!