Hipure tissue dna kit

Manufactured by Magen Biotechnology Co

Sourced in China

The Hipure tissue DNA kit is a laboratory tool designed to extract and purify DNA from various tissue samples. It utilizes a silica-based membrane technology to efficiently capture and isolate DNA molecules, enabling researchers to obtain high-quality genomic DNA for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions) Pucm t vector, by Sangon (1 mentions) 5 ml protein a column, by GE Healthcare (1 mentions) Hipure stool dna kit, by Magen Biotechnology Co (1 mentions)

Spelling variants of this product

HiPure Tissue DNA Mini Kit (22 citations) HiPure Tissue DNA Micro Kit (2 citations) HiPure Tissue and Blood DNA Kit (2 citations) HiPure Tissue & Blood DNA Kit (2 citations)

4 protocols using hipure tissue dna kit

Sichuan Pepper Seed DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genes of purified protein from Sichuan
pepper seeds were extracted using a Hipure tissue DNA kit (Magen,
Guangdong, China) according to the manufacturer’s protocol.
Briefly, 50 mg Sichuan pepper seeds were ground in liquid nitrogen
and digested overnight with Buffer ATL, which is a component of the
Hipure tissue DNA kit, before 250 μL of absolute alcohol was
added to the sample and loaded onto a HiPure gDNA Mini column. The
genomic DNA was eluted with 100 μL of Buffer AE (Magen, Guangdong,
China). Forward primer CDS1-F (GAAGCTGGCGTCACAGAGTTCTG) and reverse
primer CDS4-R (GTTCTGGATAACGTCCAACGGCAGC) were designed based on master
protein accession (Uniprot: V4S993) were obtained by mass spectrometry.
Blunt-end PCR products were ligated into a pUCm-T vector (Sangon Biotech)
after A-Tailing. Positive clones were screened on X-gal (Sango, B541006,
Shanghai, China) plates and sequenced in both directions.

Hu J., Zhu L.P., Wang R.Q., Zhu L., Chen F., Hou Y., Ni K., Deng S., Liu S., Ying W., Sun J.L., Li H, & Jin T. (2024). Identification, Characterization, Cloning, and Cross-Reactivity of Zan b 2, a Novel Pepper Allergen of 11S Legumin. Journal of Agricultural and Food Chemistry, 72(14), 8189-8199.

+ Open protocol

+ Expand

Recombinant Protein Production from Sichuan Pepper

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA of Sichuan pepper was extracted from seeds using a Hipure tissue DNA kit (Magen, Guangdong, China). PCR primers (forward: CAGAGCTGCGAGCAG CAGATAC; reverse: CCTTGGAGAAATGTTGCAC) were designed based on the α-amylase inhibitor domain-containing protein of Citrus sinensis DNA sequence. After sequencing, the DNA sequence was inserted into a pTT5-based mammalian expression vector with a human IgG-Fc tag. Then, the plasmids were transfected to HEK 293-F cells via polyfectine, and the cell culture medium was collected for purification 1 day after transfection. The protein was purified using a 5 mL Protein A column (GE Healthcare, Piscataway, NJ) pre-equilibrated with a running buffer (150 mM NaCl, 20 mM Na 2 HPO 4 , pH 7.0) with a linear gradient of 30 mL 0.1 M acetic acid. The collected protein sample was mixed with 1 M Tris (pH 7.5) at a ratio of 5: 1 to adjust the pH to neutral.

Li H., Zhu L., Wang R.Q., Zhu L., Hu J., Chen F., Ma L., Tang R., Liu S., Ni K., Ye X., Zhang Y., Sun J.L, & Jin T. (2024). A new pepper allergen Zan b 1.01 of 2S albumins: Identification, cloning, characterization, and cross-reactivity. Asian Pacific journal of allergy and immunology.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Amplification

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA samples were extracted using the HiPure Tissue DNA Kits and HiPure Stool DNA Kits (Magen, Guangzhou, China) following the manufacturer’s protocols. The concentration of DNA was assessed by Nanodrop 2000C (Thermo Scientific, Waltham, MA, USA), and purity was monitored by 1% agarose gel electrophoresis. DNA was diluted to a concentration of 100 ng/μL with sterile water. For PCR amplification, the V3-V4 region of the bacterial 16S rRNA gene was performed using the primers (341F: CCTACGGGNGGCWGCAG; 806R: GGACTACHVGGGTATC TAAT) (Guo et al., 2017 (link)). PCR reactions were performed in triplicate using a 50 μL mixture containing 5 μL of 10 × KOD Buffer, 5 μL of 2 mM dNTPs, 3 μL of 25 mM MgSO₄, 1.5 μL of each primer (10 μM), 1 μL of KOD Polymerase, and 100 ng of template DNA.

Su R.R., Pan B.Q., Luo Y.X., Zheng X.L., Lu W, & Wang X.Y. (2024). Characterization of bacterial diversity and screening of cellulose-degrading bacteria in the gut system of Glenea cantor (Fabricius) larvae. Frontiers in Bioengineering and Biotechnology, 12, 1340168.

+ Open protocol

+ Expand

DNA Extraction and PCR Amplification from Gastric Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

HiPure Tissue DNA Kits (Magen, D3121-02) were used to extract DNA from gastric mucosal tissue. PCR amplification was performed by PCR DSMIX (Dongsheng Biotech, Guangdong, China; 077). The primer sequences were as follows: forward primer: 5′-TGTGTTTCAGCTCAGTAGGCAC-3′; reverse primer: 5′-CTGTCACAAATCACATTGCC-3′. The PCR conditions were 94°C for 4 min; then 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; finally, 72°C for 10 min and 10°C 30 s. The PCR products were separated by 1% agarose gel electrophoresis (Figure 3). Then, the direct sequencing of PCR products was performed with the dideoxy-chain method.

Zhang L., Huang M.X., Li D.Y., Zhang Y.Z., Lan S.Y., Luo Q., Dai Y.K., Wu Y.B., Ye J.T., Chen W.J., Li R.L, & Hu L. (2022). The Single-Nucleotide Polymorphism of miR-27a rs895819 and the Expression of miR-27a in Helicobacter pylori-Related Diseases and the Correlation with the Traditional Chinese Medicine Syndrome. Evidence-based Complementary and Alternative Medicine : eCAM, 2022, 3086205.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!