Rnaeasy animal rna isolation kit

Total RNA was isolated from the cells using the RNAeasy™ Animal RNA Isolation Kit (Beyotime, Cat# R0027, China) according to the manufacturer’s instructions. To synthesize cDNA, 1 μg of the isolated total RNA was used as a template in a reverse transcription reaction. The HiScript Q RT SuperMix for qPCR kit (Vazyme, Cat# R223, China) was utilized following the manufacturer’s protocol. Real-time quantitative PCR (qPCR) was performed using the ChamQ SYBR Color qPCR Master Mix (Vazyme, Cat# Q321, China) in accordance with the manufacturer’s instructions. The relative mRNA expression levels were determined using the 2^−ΔΔCt method. The primer sequences used were as follows:
GPX4-Forward: CGGAATTCATGAGCCTCGGCCGCCTTTG;
GPX4-Reverse: CCGCTCGAGGAAATAGTGGGGCAGGTCCT;
GAPDH-Forward: GTCTCCTCTGACTTCAACAGCG;
GAPDH-Reverse: ACCACCCTGTTGCTGTAGCCAA.

Total RNA was isolated using the RNAeasy™ Animal RNA Isolation Kit (Cat# R0027; Beyotime) following the manufacturer's instructions. The HiScript Q RT SuperMix for qPCR kit (Cat# R223; Vazyme) was utilized following the manufacturer's protocol to synthesize complementary DNA. RT‐qPCR was performed using the ChamQ SYBR Color qPCR Master Mix (Cat# Q321; Vazyme) following the manufacturer's instructions (Tables 1 and 2). The primer sequences used for RT‐qPCR were as follows: IGF2BP2‐Forward: AGTGGGAGGTGTTGGATGG; IGF2BP2‐Reverse: CGGTTTCTGTGTCTGTGTTG; GAPDH‐Forward: GTCTCCTCTGACTTCAACAGCG; GAPDH‐Reverse: ACCACCCTGTTGCTGTAGCCAA. To quantify the relative mRNA expression levels, the established 2−∆∆Ct method was applied.
³⁷ (link)

Total RNA was extracted using RNAeasy™ Animal RNA Isolation Kit (Beyotime) according to the manufacturer’s instruction. Subsequently, 500 ug total RNA was used to synthesize cDNA using PrimeScript™ RT Master Mix (Thermo Fisher Scientific, United States). RT-qPCR was performed using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, United States) according to the manufacturer’s protocol, in CFX96 Real-Time System (Bio-Rad Laboratories, United States). The total volume of each PCR reaction is 10 μL, including 5 μL SYBR Green Master Mix (2 x), 2 µL RNase-free dH2O, 0.5 µL of each primer (Table 2) and 2 µL diluted cDNA. The results were normalized to the GAPDH level and evaluated by using the 2^−ΔΔCt method (Schmittgen et al., 2008 (link)).

RNA was extracted using an RNAeasy™ Animal RNA isolation kit with a spin column (Beyotime, #R0026), and miRNA was extracted using a SanPrep column miRNA extraction kit (Sangon Biotech, #B518811), according to the manufacturer’s instructions. RNA reverse transcription, cDNA verification, preparation of a real-time PCR system, and determination of the reaction conditions were carried out as described previously. β-actin and U6 were the reference genes. The primers are listed in Table 3.

Total RNA was isolated using the RNAeasy™ Animal RNA Isolation Kit (Beyotime, Cat# R0027, China) following the manufacturer’s instructions. The quality and quantity of the total RNA were assessed using the Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, Cat# 5067-1511, USA). High-quality RNA samples with a RIN (RNA Integrity Number) greater than 7.0 were selected for library construction. To enrich for mRNA, Dynabeads Oligo (dT) (Thermo Fisher, USA) was used for purification. The purified mRNA was then fragmented into short fragments. Subsequently, the cleaved RNA fragments were reverse transcribed to synthesize cDNA using SuperScript™ II Reverse Transcriptase (Invitrogen, Cat# 1896649, USA). The constructed cDNA libraries were subjected to 2 × 150 bp paired-end sequencing (PE150) on an Illumina Novaseq™ 6000 (LC-Bio Technology CO., Ltd., Hangzhou, China) following the vendor’s recommended protocol. For gene expression analysis, DESeq2 software was used to compare gene expression levels between two different groups, and edgeR was used to compare gene expression between two samples. Genes with a false discovery rate (FDR) below 0.05 and an absolute fold change of at least 2 were considered as differentially expressed genes (DEGs).

L-15 leibovitz cell culture medium and Dulbecco’s modified eagle medium (DMEM) with high glucose were from HyClone (Logan, Utah, USA); FBS was obtained from Invitrogen (Carlsbad, CA, USA); antibiotics (penicillin, streptomycin, and amphotericin B), PBS, Percoll and trypan blue were from Solarbio (Beijing, China); sodium acetate, sodium propionate, sodium butyrate, and trichostatin A were purchased from Sigma (St. Louis, MO, USA); antibody against HIF-1α, dimethyl-bisphenol A and chrysin were from Santa Cruz (Santa Cruz, CA, USA); BBoxiProbe™ R01 kit was from BestBio (Shanghai, China); RNAeasy™ animal RNA isolation kit, reactive oxygen species assay kit and DAF-FM DA were purchased from Beyotime (Shanghai, China); HiScript^® III RT SuperMix for qPCR was from Vazyme (Nanjing, China); SYBR green qPCR kit was from Accurate Biology (Hunan, China); Pertussis toxin was obtained from APE×BIO (Houston, Texas, USA); Lysozyme assay kit was from Jiancheng (Nanjing, China).