Abi 7500 system

Total RNA was isolated from patient tissues and thyroid cancer cell lines by TRIzol reagent (Invitrogen, United States). All RNA specimens were temporarily stored at -80°C. The isolated RNA was analyzed at 260/280 nm, which ranges from 1.81 to 1.97. RNA reverse transcription was accomplished by the ReverTra Ace qPCR RT Kit (Toyobo, Japan). Real-time PCR was carried out and analyzed through an ABI 7500 System (Life Technologies, United States). The relative expression of MVP mRNA was presented using the normalized method of 2^−ΔΔCT with the endogenous control GAPDH. The primer sequences were as follows: MVP forward primer, 5′- CCC​AAC​ACT​GCC​CTC​CAT​CTA​AAG-3'; MVP reverse primer, 5′- ATC​TCC​ACG​ACC​TCC​ACT​TCC​TTC-3'; GAPDH forward primer, 5′- GTC​TCC​TCT​GAC​TTC​AAC​AGC​G-3'; GAPDH reverse primer, 5′- ACC​ACC​CTG​TTG​CTG​TAG​CCA​A-3'.

Total mRNA was extracted from cells using TRIzol (Invitrogen) and converted into cDNA using HiScript^® II Q RT SuperMix (Vazyme Biotech, Nanjing, China). Quantitative RT-PCR was performed using an ABI-7500 system (Life Technologies, USA). The primer sequences used for RT-PCR are as follows: IL-6, forward: 5′-TAACCACCCCTGACCCAACCA-3′, reverse: 5′-GCGCAGAATGAGATGAGTTGTCA-3′, a fluorescent probe, 5′-AAATGCCAGCCTGCTGACGAAGCTGCA-3′; glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward:5′-GGACAGGACCATATTGAGGGACA, reverse: 5′- AGGAGTGAGTGGAAGACAGAATGGA, a fluorescent probe, TGGAAGGAGCACTTCATCTGTT; IL-1α, forward: 5′-GCGTTTGAGTCAGCAAAGAAGTC, reverse: 5′-GGAGTGGGCCATAGCTTACA; and IL-1β, forward: 5′-TCGCCAGTGAAATGATGGCT, reverse: 5′-TGGAAGGAGCACTTCATCTGTT. Expression relative to that of the control sample was calculated as follows: 2 −ΔΔCt = 2 ^−(ΔCt [sample] − ΔCt [control]).

Total RNA was extracted by using Trizol reagent according to the manufacturer’s instructions and reverse-transcribed into cDNA. PCR experiments were then conducted with ABI7500 system (Life Technologies, United States) by TB Green^TM Premix Ex Taq^TM (Tli RNaseH Plus) and ROX plus kit [Takara Biomedical Technology (Beijing) Co., Ltd., China]. GAPDH was used as a housekeeping gene. The mRNA levels were calculated by using the ^ΔΔCT method. The sense and antisense primers (TNF-α, IL-1β, IL-6, and GAPDH) as follows were purchased from Sangon Biotech (Shanghai) Co., Ltd. (China). TNF-α: 5′-TACTGAACTTCGGGGTGATTGGTCC-3′ and 5′-CAGCCTTGTCCCTTGAAGAGAAC-3′. IL-1β: 5′-GCACTACAGGCTCCGAGATGAAC-3′ and 5′-TTGTCGTTGCTTGGTTCTCCTTGT-3′. IL-6: 5′-CCGGAGAGGAGACTTCACAG-3′ and 5′-GGAAATTGGGGTAGGAAGGA-3′. GAPDH: 5′-ACCACAGTCCATGCCATCAC-3′ and 5′-CACCACCCTGTTGCTGTAGCC-3′.

Total RNA was isolated from CD8⁺ T cells using the miRNeasy Mini Kit (Qiagen, Germantown, MD, USA). PrimeScript RT Master Mix (Takara, Otsu, Japan) was used for reverse transcription following the manufacturer's standard protocol. Cytokine expression levels were determined using an ABI 7500 system (Life Technologies, Foster City, CA, USA) and SYBR Green. Primer sequences used were TGF-β1: 5′-CAGCAACAATTCCTGGCGATAC-3′ and 5′-TCAACCACTGCCGCACAACT-3′; IFN-γ: 5′-GTTT TGGGTTCTCTTGGCTGTTA-3′ and 5′-AAAAGAGTTC CATTATCCGCTACATC-3′; TNF-α: 5′-CCCCAGGGACC TCTCTCTAATC-3′ and 5′-GGTTTGCTACAACATGG GCTACA-3′; IL-2: 5′-GAATGGAATTAATAATTACA AGAATCCC-3′ and 5′-TGTTTCAGATCCCTT TAGTT CCAG-3′; IL-10: 5′-GCTGGAGGACTTTAAGGGTTA CCT-3′ and 5′-CTTGATGTCTGGGTCTTGGTTCT-3′; β-actin: 5′-GAGCTACGAGCTGCCTGACG-3′ and 5′-GT AGTTTCGTGGATGCCACAG-3′. Cycle threshold (CT) values were estimated by normalizing these values against β-action CT values using the 2^−ΔΔCt method.

Total RNA was extracted from the 5 heads of drosophila using Trizol reagent (Invitrogen) according to the protocol. cDNA was synthesized using the Reverse Transcription System Kit (Takara, Beijing, China). The qRT-PCR test was performed by SYBR Green PCR Master Mix (Takara) and detected on ABI 7500 system (Life technology, Carlsbad, CA, USA). The primers for cncc were 5′-GAGGTGGAAATCGGAGATGA-3′ and 5′-CTGCTTGTAGAGCACCTCAGC-3′, the β-actin was used to normalize the relative level of gene expression and the primers were 5′- GGA GAT TAC TGC CCT GGC TCC TA-3′ and 5′-GGA GAT TACTGC CCT GGC TCC TA-3′.

Total RNAs from rice tissues (anthers, young panicles, leaves and stems) of HJX74, SSSL-S23 and their hybrid were isolated using TRIZOL reagent (Invitrogen) following the manufacturer’s instruction. First-strand cDNA was reverse transcribed from DNaseI-treated RNA with oligo-dT as the primer using ReverTra Ace kit (Toyobo). For the RACE assay, the full-length transcripts were amplified by nested PCR with the SMARTer RACE cDNA Amplification kit (Clontech). Gene expression was measured by qRT-PCR using the ABI 7500 system (Life technologies). The qRT-PCR was carried out in a total volume of 20 μl containing 1× SYBR Green Master Mix (Life technologies). We normalized the expression levels by using UBQ5 gene as internal control. Each set of experiments was repeated three times, and the relative standard curve quantification method was used to evaluate quantitative variation. The qRT-PCR procedure was conducted at 94 °C for 3 min, followed by 40 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. The primers used were listed in Additional file 2: Table S1.

Total RNA was isolated using TRIZol reagent (Life Technology, USA) and complementary DNA (cDNA) was obtained by performing reverse transcription using Quantitect Reverse Transcription Kit (Qiagen, Germany). Quantitative gene expressions were analyzed using FastStart Universal SYBR Green Master (Roche diagnostics, Germany) on a ABI7500 system (Life Technology). PCR condition was as follows: 10 min at 95°C, followed by 35 cycles of 95°C for 30 s and 60°C for 60 s. β-actin was used as an internal control, and expressing level of target genes were calculated using the ΔCq method. Primers used were as follows: COX1 forward 5’- CGTTGTAGCCCACTTCCACT-3’ and reverse 5’- TGGCGTAGGTTTGGTCTAGG-3’; COX3 forward 5’- CAATTACATGAGCTCATCATAGC -3’ and reverse 5’- CCATGGAATCCAGTAGCCA -3’; ND1 forward 5’- CCTAAAACCCGCCACATCTA-3’ and reverse 5’- GCCTAGGTTGAGGTTGACCA-3’; Cyb forward 5’- ATCACTCGAGACGTAAATTATGGCT -3’ and reverse 5’- TGAACTAGGTCTGTCCCAATGTATG -3’; Ubiquitin forward 5’- ATTTGGGTCGCGGTTCTTG -3’ and reverse 5’- TGCCTTGACATTCTCGATGG -3’; β-actin forward 5’- TGCGTTACACCCTTTCTTGACA -3’ and reverse 5’- GCAAGGACTTCCTGTAACAATG -3’.