Ibright cl750 imaging system

Lysate preparation and western blot analysis were performed as previously described^{16 (link)}. Total proteins were separated using 8–12% sodium dodecyl sulfate‒polyacrylamide agarose gel electrophoresis (SDS‒PAGE) and transferred to nitrocellulose membranes. The primary antibodies were as follows: Bcl-xL (Cat. sc-634; Santa Cruz Biotechnology, Dallas, TX, USA), Cathepsin D (Cat. sc-377299; Santa Cruz Biotechnology), Arg1 (Cat. sc-18354; Santa Cruz Biotechnology), CCL20 (Cat. sc-51744; Santa Cruz Biotechnology), E-cadherin (Cat. ab40772; Abcam, Burlingame, CA, USA), TGFBI (Cat. ab189778; Abcam), Cox2 (Cat. ab15191; Abcam), vimentin (Cat. 3390; Cell Signaling Technology, Danvers, MA, USA), Snail (Cat. 3879; Cell Signaling Technology), Src (Cat. 8056; Cell Signaling Technology), p-Src (Cat. 2101; Cell Signaling Technology), STAT1 (Cat. 9172; Cell Signaling Technology), p-STAT1 (Cat. 9171; Cell Signaling Technology), Myc-Tag (Cat. 2276; Cell Signaling Technology) and actin (Cat. A5441, Sigma‒Aldrich, St Louis, MO, USA). Subsequently, the membranes were incubated with HRP-conjugated anti-mouse or anti-rabbit secondary antibodies for 1 h at room temperature. The signals were detected and quantified using an iBright CL750 imaging system (Invitrogen, Carlsbad, CA, USA).

HUVEC total proteins on the chip and 2.5D collagen bed were extracted using RIPA cell lysis buffer (1×, GenDepot, USA) supplemented with Halt protease and phosphatase inhibitor cocktail (Thermo Scientific, USA). Nucleus and cytoplasmic fractionation were performed using NE‐PER nuclear and cytoplasmic extraction reagents (Thermo Scientific, USA) following the manufacturer's manual. The concentrations of extracted proteins were measured using the Bradford assay (Bio‐Rad Protein assay dye reagent concentrate, USA). Exactly 10 µg of protein was used for sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE), then transferred to NitroPure nitrocellulose transfer membrane (LC7033‐300, GenDepot, USA) for blotting. Primary antibodies and HRP‐conjugated secondary antibodies were used to label target proteins. Protein expression was detected using West‐Q Pico Dura ECL solution (W3653, GenDepot, USA) and membranes were imaged using iBright CL750 Imaging System (A44116, Invitrogen, USA).
Expressions of VE‐cadherin and F‐actin protein were measured using ImageJ. VE‐cadherin and F‐actin band signals were normalized to the loading control signal. For better comparison, the normalized values were calculated as fold changes relative to the iso‐osmotic control.

SDS-PAGE was performed on protein extracts obtained from human CD4⁺ T cell activated in vitro as previously described. Western blotting was performed as previously described (Ricciardi et al., 2018 (link)). The following antibodies were used for Western blotting: rabbit polyclonal to phospho-rpS6 Ser235/236 (1:1000, Cell Signaling), rabbit polyclonal to phospho-rpS6 Ser240/244 (1:1000, Cell Signaling), mouse monoclonal anti-Vinculin (1:1000, Millipore), mouse monoclonal anti-Actin (1:1000, Sigma), mouse monoclonal anti-Puromycin (1:10000, Millipore). Chemiluminescent signals were detected using Amersham ECL Prime (GE Healthcare Life Sciences) and images were acquired using the iBright CL750 Imaging System (Thermo Fisher Scientific).
Where indicated, cells were treated with either 2 μM PP242 (Sigma-Aldrich) or 3 μM MNK inhibitor (Sigma-Aldrich) for 30  min after 48 hr of Dynabeads stimulation.

One-third of the mouse heart apex was used for western blot detection. Protein lysis and extraction were performed with RIPA lysis buffer (R0010, Solarbio, China), and the quantification of extracted protein was determined with a BCA protein kit (PC0020, Solarbio, China). Afterward, protein lysates were electrophoresed with SDS-PAGE and transferred to a polyvinylidene fluoride membrane, which was blocked with BSA (5%, SW3015, Solarbio, China) for 2 h and incubated with primary antibodies and secondary antibodies. The visualisation of membranes was performed by an ECL kit (PE0010, Solarbio, China) on an iBright CL750 Imaging System (A44116, Thermo Fisher Scientific, USA).
The antibodies purchased from Abcam (UK) used in this study were as follows: anti-Notch1 antibody (ab52627), anti-Hes1 antibody (ab108937), anti-ATF4 antibody (ab216839), anti-PERK antibody (ab229912), anti-phospho-PERK antibody (ab192591), anti-caspase-3 antibody (ab184787), anti-cleaved caspase-3 antibody (ab214430), anti-β-actin antibody (ab8226), goat anti-rabbit (ab205718), goat anti-mouse (ab6789) and anti-NICD antibody (2423S, CST). β-Actin was employed as an internal control.

The prevalence of the exoU gene in different clinical isolates was determined by PCR. Briefly, exoU was amplified with primers (exoU-F: ATGCATATCCAATCGTTGGG, exoU-R: TCATGTGAACTCCTTATTCCGC). PCR was carried out as follows: 2-µL template genomic DNA (50–100 ng), 10 µM of each primer, 12.5 µL of 2 × Phanta Flash Master Mix (Vazyme), added ddH₂O to a final volume of 25 µL. The DNA was amplified using the following protocol: 98°C for 30 s, then 30 cycles at 98°C for 10 s, Tm for 5 s and 72°C for 15 s, then a final extension at 72°C for 1 min. PCR products were separated in 1% agarose gel for 30 min at 120 V, stained with Gel-Green (Beyotime, China) and detected by iBright CL750 Imaging System (Thermo Fisher Scientific).