Total RNAs from LX-2 cells transfected with or without silencing/overexpression plasmid of FBXW7 and/or DLL1 were isolated using the RNA isolation kit (AM1912; Invitrogen, USA). After RNA quantitation, complementary DNAs (cDNAs) were synthesized from the extracted RNAs using a cDNA synthesis kit (18090010; Invitrogen, USA) according to the instructions. With addition of PCR Master Mix (FPCR-RO, Sigma-Aldrich, St Louis, MO, USA) and specific PCR primers, cDNA amplification was performed according to the reaction condition below: 45 cycles of annealing at 95°C for 15 s, followed by 55°C for 60 s and 72°C for 60 s. The relative mRNA levels were calculated using the 2−ΔΔCt method [25 (link)], and then normalized against GAPDH. All sequences of primers in this reaction are as follows (5′–3′): FBXW7 (GTGAGAGAACGCTGAGGAGG, GGGACAGTCAGGTTTGGGAG), α-SMA (CTGTTCCAGCCATCCTTCAT, CGGCTTCATCGTATTCCTGT), Collagen I (GATTCCCTGGACCTAAAGGTGC, AGCCTCTCCATCTTTGCCAGCA), DLL1 (CTCGGTGATGCCTACCTGTG, ACACTCGCACACATAGCGGT), and GAPDH (TCAAGGCTGAGAACGGGAAG, TGGACTCCACGACGTACTCA).
Pcr master mix
Manufactured by Merck Group
Sourced in United States
The PCR Master Mix is a ready-to-use solution containing all the necessary components for performing Polymerase Chain Reaction (PCR) amplification. It includes a thermostable DNA polymerase, buffer, dNTPs, and other essential reagents. The PCR Master Mix is designed to simplify and streamline the PCR setup process, providing a convenient and consistent approach to DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
One dimensional gel documentation system, by Bio-Rad (1 mentions)
Nutrient agar, by Thermo Fisher Scientific (1 mentions)
Mueller hinton broth and agar, by Thermo Fisher Scientific (1 mentions)
Vancomycin, by Merck Group (1 mentions)
Tryptone soya agar, by Thermo Fisher Scientific (1 mentions)
Verapamil, by Merck Group (1 mentions)
6 protocols using pcr master mix
1
Quantifying FBXW7 and DLL1 mRNA Levels
2
Profiling Adiponectin Gene Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To profile the methylation of the ADIPOQ gene, the CpG site located at the − 74 nt sequence of the E-box was examined using Methylation-Specific PCR and restriction analysis. The choice of CpG site (− 74nt) in the promoter of the adiponectin gene is based on a study by García-Cardona et al. [33 (link)]. Amplification of Bisulfite-Treated DNA was performed on Mastercycler instrument (Eppendorf) using PCR Master Mix (cat.no:4351376, Sigma-Aldrich) in 50 µL of RNAse-free water containing 0.4 µM primers (Table 1 , SibEnzyme LLC, Novosibirsk). The following PCR conditions were used: 4 min of initial denaturation at 95 °C, 1 min of denaturation at 94 °C, 15 s of annealing at 53 °C, and 1 min of extension at 72 °C. The PCR cycle was repeated 40 times with a final extension at 72 °C for 10 min, followed by cooling to 4 °C.
A list of primers
| # | Primer name | Primer sequence 5′ –» 3′ | Gene | PCR product |
|---|---|---|---|---|
| 1 | − 74nt—F | TGCCCCATCTTCTGTTGCTG | − 74nt ADIPOQ | 186 base pairs |
| 2 | − 74nt—R | AACTCGATGAGGGCCAGAGG | ||
| 3 | Beta-globin—F | CCACTTCATCCACGTTCACC | Beta-globin | 268 base pairs |
| 4 | Beta-globin—R | GAAGAGCCTAGGACAGGTAC |
3
PCR Amplification of H. pylori glmM
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplification of glmM gene of H. pylori by PCR assay was as follows: final volume of 25 μl reaction mixture contained 3 μl template DNA, 10 μl PCR Master Mix (sigma), 1 μl forward (5' AAGCTTTTAGGGGTGTTAGGGGTTT 3') and (5' AAGCTTACTTTCTAACACTAACGC 3') reverse primers[13 (link)] and 5 μl molecular grade water. The cycling conditions were as follows: initial denaturation at 95°C for 3 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min, with final extension at 72°C for 7 min.
4
DNA Extraction and Molecular Detection of Cholera Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted DNA from the isolates using the boiling method. In brief, a loopful of cultured bacteria was suspended in 100 μL of sterile Tris-EDTA (TE) buffer. The samples were boiled for 10 min at 100 °C and then immediately cooled in ice water. Samples were centrifuged for 5 min at 6000× g to remove the supernatant. The extracted DNA was stored at −20 °C until use [56 (link)]. Routine PCR was adopted for molecular detection of the universal 16S rRNA gene and specific target outer membrane protein (Omp W) of cholera strains. PCR amplification was performed for 5 min at 94 °C in a total reaction volume of 25 μL containing 12.5 μL PCR master mix (Sigma), 4.5 μL PCR-grade water, 1 μM of each primer (10 pmol), and 6 μL DNA template. For the initial denaturation of DNA in 35 cycles, each cycle lasted 30 s at 94 °C, 2 min at 59 °C, and 1 min at 72 °C, with a final extension for 7 min at 72 °C in a DNA gradient temperature cycler. For each reaction mixture, 10 μL was subjected to electrophoresis on a 1.5% agarose gel. The gel containing the amplified DNA was stained with ethidium bromide and visualized with an ultraviolet transilluminator. Then, images from the transilluminator were digitized with a one-dimensional gel documentation system (BioRad).
5
Carbapenemase Detection by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Major groups of carbapenemases, including class-D (OXA-23, OXA-58, OXA-24) and Class-B (NDM-1, VIM, SIM & IMP) beta-lactamases were detected by PCR along with the intrinsically encoded gene OXA-51. PCR was performed using ready-to-use PCR master mix (Sigma Aldrich, St. Louis, MO, USA) in the ‘Veriti’ PCR machine (Applied Biosystems, Foster City, CA, USA).
6
Antimicrobial Susceptibility Testing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mueller Hinton agar and broth, Tryptone soya agar, Nutrient agar and broth and agar were obtained from Oxoid, Hampshire, England in dehydrated form.
Domperidone, atorvastatin, nifuroxazide, sulfamethoxazole-trimethoprim, ampicillin-sulbactam and mebeverine were obtained from Egyptian Pharmaceutical Industries Company (EPICO), Egypt, while vildagliptin and metformin were obtained from National Pharmaceutical Company (NAPCO), Egypt. Imipenem as Tienam® powder for IV infusion was the marketed pharmaceutical product manufactured by Merck & Co., Inc, USA. Linezolid, levofloxacin, amikacin and doxycycline were obtained from PHARCO Company, Egypt. Clindamycin was kindly granted from PFIZER Company. PCR master mix, Agarose DNA grade, DNA marker (100 bp), Tris-acetate-EDTA (TAE) buffer (50X), verapamil, vancomycin and the PCR primers13 (link) (table 1 ), provided by Integrated DNA Technologies were purchased from Sigma Aldrich, St. Louis, Mo, USA. DNase free water used for PCR reaction mixture was the product of Thermo Fisher Scientific, USA.
Domperidone, atorvastatin, nifuroxazide, sulfamethoxazole-trimethoprim, ampicillin-sulbactam and mebeverine were obtained from Egyptian Pharmaceutical Industries Company (EPICO), Egypt, while vildagliptin and metformin were obtained from National Pharmaceutical Company (NAPCO), Egypt. Imipenem as Tienam® powder for IV infusion was the marketed pharmaceutical product manufactured by Merck & Co., Inc, USA. Linezolid, levofloxacin, amikacin and doxycycline were obtained from PHARCO Company, Egypt. Clindamycin was kindly granted from PFIZER Company. PCR master mix, Agarose DNA grade, DNA marker (100 bp), Tris-acetate-EDTA (TAE) buffer (50X), verapamil, vancomycin and the PCR primers13 (link) (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!