Log In Sign up
The largest database of trusted experimental protocols

Fam gapdh assay

Manufactured by Bio-Rad
Visit Supplier

The FAM GAPDH assay is a real-time PCR (polymerase chain reaction) reagent designed to detect and quantify the expression of the GAPDH gene, which is commonly used as a reference gene for gene expression analysis. The assay utilizes a FAM-labeled probe to provide specific and sensitive detection of the GAPDH target.

Automatically generated - may contain errors

Lab products found in correlation

Iscript cdna synthesis kit, by Bio-Rad (2 mentions) Direct zol rna microprep kit, by Zymo Research (2 mentions) B cell isolation kit, by Miltenyi Biotec (2 mentions) Qx200, by Bio-Rad (2 mentions)

Close spelling variants of this product

GAPDH (172 citations)

2 protocols using fam gapdh assay

1

Quantifying MHC Class II Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
B cells were purified from spleens of MHCIIb/b, MHCIIb/null, and MHCIInull/null mice using magnetic separation with a B cell isolation kit according to the manufacturer’s instructions (130-090-862, Miltenyi Biotec). RNA was purified using TRI Reagent and the Direct-zol RNA Microprep kit (R2061, Zymo Research), and cDNA was generated using iScript cDNA synthesis kit (1708890, Bio-Rad). Digital droplet PCR was performed on a QX200 (Bio-Rad), multiplexing a FAM GAPDH assay (dMmuCPE5195282, Bio-Rad) and H2-Aa primer and HEX probe set (forward: CAATTGGCAAGCTTTGACCCC, reverse: TTGGGGAACACAGTCGCTTG, probe: [HEX]CCACCCCAGCTACCAATGAGGC[MGBEQ]).
Fahlquist-Hagert C., Wittenborn T.R., Terczyńska-Dyla E., Kastberg K.S., Yang E., Rallistan A.N., Markett Q.R., Winther G., Fonager S., Voss L.F., Pedersen M.K., van Campen N., Ferapontov A., Jensen L., Huang J., Nieland J.D., van der Poel C.E., Palmfeldt J., Carroll M.C., Utz P.J., Luo Y., Lin L, & Degn S.E. (2023). Antigen presentation by B cells enables epitope spreading across an MHC barrier. Nature Communications, 14, 6941.
+ Open protocol
+ Expand
2

Quantifying MHC Class II Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
B cells were purified from spleens of MHCIIb/b, MHCIIb/null, and MHCIInull/null mice using magnetic separation with a B cell isolation kit according to the manufacturer’s instructions (130-090-862, Miltenyi Biotec). RNA was purified using TRI Reagent and the Direct-zol RNA Microprep kit (R2061, Zymo Research), and cDNA was generated using iScript cDNA synthesis kit (1708890, Bio-Rad). Digital droplet PCR was performed on a QX200 (Bio-Rad), multiplexing a FAM GAPDH assay (dMmuCPE5195282, Bio-Rad) and H2-Aa primer and HEX probe set (forward: CAATTGGCAAGCTTTGACCCC, reverse: TTGGGGAACACAGTCGCTTG, probe: [HEX]CCACCCCAGCTACCAATGAGGC[MGBEQ]).
Fahlquist-Hagert C., Wittenborn T.R., Terczyńska-Dyla E., Kastberg K.S., Yang E., Rallistan A.N., Markett Q.R., Winther G., Fonager S., Voss L.F., Pedersen M.K., van Campen N., Ferapontov A., Jensen L., Huang J., Nieland J.D., van der Poel C.E., Palmfeldt J., Carroll M.C., Utz P.J., Luo Y., Lin L, & Degn S.E. (2023). Antigen presentation by B cells enables epitope spreading across an MHC barrier. Nature Communications, 14, 6941.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!