Log In Sign up
The largest database of trusted experimental protocols

Cfx connect 96 real time pcr system

Manufactured by Bio-Rad
Visit Supplier
Sourced in United States

The CFX-Connect 96 Real-Time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is capable of performing precise, quantitative detection and analysis of nucleic acid sequences.

Automatically generated - may contain errors

Lab products found in correlation

Iscript cdna synthesis kit, by Bio-Rad (2 mentions) Itaq sybr green supermix, by Bio-Rad (2 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Reverse transcription kit, by Takara Bio (1 mentions) Nd 1000 spectrophotometer, by Promega (1 mentions) Taqman pcr master mix, by Thermo Fisher Scientific (1 mentions) Reliaprep rna cell miniprep system, by Promega (1 mentions) Goscript reverse transcriptase, by Promega (1 mentions)

Spelling variants of this product

CFX Connect (733 citations) CFX Connect Real-Time PCR System (637 citations) CFX Connect system (312 citations) Real-Time System (61 citations) CFX Connect Real-Time PCR (50 citations) CFX Connect PCR system (26 citations) CFX Connect 96 (9 citations) Connect Real-Time PCR System (8 citations) Connect Real-Time PCR (3 citations) CFX Connect Real-PCR system (2 citations)

6 protocols using cfx connect 96 real time pcr system

1

Quantifying PIEZO1 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the TRIzol reagent and reverse‐transcribed into cDNA using a reverse transcription kit (TAKARA, Japan). RT‐qPCR was performed using the SYBR FAST qPCR Master Mix in a CFX‐Connect 96 Real‐Time PCR System (Bio‐Rad, USA). GAPDH was used as an internal reference gene. The relative expression of PIEZO1 was calculated using the 2−ΔΔCt method. Primer sequences were as follows: PIEZO1 forward primer, 5′‐TCTTCCTTAGCCATTACTACCT‐3′, PIEZO1 reverse primer, 5′‐TACGCTCCATCTGTCTTTTC‐3′. GAPDH forward primer, 5′‐GGGAAACTGTGGCGTGAT‐3′, GAPDH reverse primer, 5′‐GAGTGGGTGTCGCTGTTGA‐3′.
Bo H., Wu Q., Zhu C., Zheng Y., Cheng G, & Cui L. (2024). PIEZO1 acts as a cancer suppressor by regulating the ROS/Wnt/β‐catenin axis. Thoracic Cancer, 15(12), 1007-1016.
+ Open protocol
+ Expand
2

Hypoxia-Responsive Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells
using ReliaPrep RNA Cell Miniprep System (Promega) and quantified
using a Nanodrop ND-1000 spectrophotometer. Complementary cDNA was
synthesized in a 20 μL reaction using 1 μg of total RNA
with GoScript Reverse Transcriptase (Promega) according to the manufacturer’s
instructions. Quantitative real-time PCR (RT-qPCR) was performed using
Universal Taqman PCR master mix (Applied Biosystems) and the TaqMan
gene expression assays of interest (Applied Biosystems) on a CFX-connect
96 Real-Time PCR system (Bio-Rad). Expression assays used in this
study were: 18S (Hs99999901_s1), ActB (Hs99999903_m1), VEGF (Hs00900055_m1),
CAIX (Hs00154208_m1), HIF-1α (Hs00153153_m1) and EPAS1 (Hs01026149_m1).
Expression values were expressed as ΔΔCT normalized
to expression of 18S and β-Actin and normoxic gene expression.
Hypoxia focused microarray was conducted using TaqMan Array Human
Hypoxia plates (Applied Biosystems). Expression values were expressed
as ΔΔCT normalized to expression of 18S and
normoxic gene expression.
Mistry I.N, & Tavassoli A. (2016). Reprogramming the Transcriptional Response to Hypoxia with a Chromosomally Encoded Cyclic Peptide HIF-1 Inhibitor. ACS Synthetic Biology, 6(3), 518-527.
+ Open protocol
+ Expand
3

MXene Micropatterning Impacts on Cardiac Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To observe the effect of MXene and patterning separately, three different sample types were prepared: (i) iCMs seeded on glass only, (ii) 1 mm2 Ti3C2Tx MXene squares printed on PEG (unpatterned), and (iii) Hilbert’s curve-patterned Ti3C2Tx MXene printed on PEG (patterned). After one week in culture, RNA was collected using a total RNA isolation kit (RNeasy, Qiagen, USA). The purity and concentration of RNA were measured using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA). Using the iScript cDNA Synthesis Kit (Bio-Rad, USA), RNA was converted into cDNA. Certified human gene-specific primers were purchased from Bio-Rad (Table S2). For qRT-PCR reactions, iTaq SYBR Green Supermix (Bio-Rad, USA) was used and the reactions were run on CFX Connect 96 Real Time PCR system (Bio-Rad, USA) in duplicates. To quantify the relative expression of genes, ΔΔCt method was applied using GAPDH as the housekeeping gene.
Basara G., Saeidi-Javash M., Ren X., Bahcecioglu G., Wyatt B.C., Anasori B., Zhang Y, & Zorlutuna P. (2020). Electrically conductive 3D printed Ti3C2Tx MXene-PEG composite constructs for cardiac tissue engineering. Acta biomaterialia, 139, 179-189.
+ Open protocol
+ Expand
4

Thermostability of NylC-TS Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols
The thermostabilities of the NylC-TS variants were determined using differential scanning fluorimetry (DSF). For each protein, a 5 µM sample of protein was prepared in reaction buffer and SYPRO Orange dye (provided at a 5000X concentration from the manufacturer), added to a final concentration of 10X. DSF was carried out using a Bio-Rad CFX Connect 96-Real Time PCR system, using the FRET channel for excitation and emission settings, and CFX Manager (version 2.0) for data collection. The temperature was increased with an increment of 0.3 °C/s from 25 °C to 95 °C. The Tm was then determined from the peak of the first derivative of the melt curve from three replicate measurements.
Bell E.L., Rosetto G., Ingraham M.A., Ramirez K.J., Lincoln C., Clarke R.W., Gado J.E., Lilly J.L., Kucharzyk K.H., Erickson E, & Beckham G.T. (2024). Natural diversity screening, assay development, and characterization of nylon-6 enzymatic depolymerization. Nature Communications, 15, 1217.
+ Open protocol
+ Expand
5

Quantitative RT-PCR Protocol for mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
We extracted total RNA from cultured cells with AG RNAex Pro Reagent (AGbio, Hunan, China), and performed cDNA synthesis with 1 μg of total RNA with Evo M-MLV RT Kit (AGbio) based on the manufacturer’s instructions. We performed qRT-PCR to detect relevant mRNA expression with an SYBR® Green Premix Pro Taq HS qPCR Kit (AGbio) and a CFX Connect 96 Real-Time PCR System (Bio-Rad, Singapore). The expression level of mRNA relative to GAPDH was assessed by the 2−ΔΔCt method. The qRT-PCR primer sequences are listed in Supplementary Table 1.
Liu A., Li Y., Lu S., Cai C., Zou F, & Meng X. (2023). Stanniocalcin 1 promotes lung metastasis of breast cancer by enhancing EGFR–ERK–S100A4 signaling. Cell Death & Disease, 14(7), 395.
+ Open protocol
+ Expand
6

Comprehensive RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was collected from iCMs at different days of differentiation using a total RNA isolation kit (RNeasy, Qiagen). Fixed human heart tissue samples were first snap-frozen in liquid nitrogen, homogenized using mortar-pestle and then lysed in Trizol. After tissue debris was separated through centrifugation, the supernatant was mixed with chloroform and shaken vigorously for 30 sec. The solution was then centrifuged following the incubation step for phase separation. RNA was collected from the upper layer formed after centrifugation, using a total RNA isolation kit (RNeasy, Qiagen). RNA purity and concentration were measured on a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific). RNA was converted into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). Validated human gene-specific primers were purchased from Bio-Rad (Supplementary Table 2). iTaq SYBR Green Supermix (Bio-Rad) was used for qRT-PCR reactions and run on CFX Connect 96 Real-Time PCR system (BioRad) in triplicates. The relative expression of genes was quantified by the ΔΔCt method using GAPDH as the housekeeping gene.
Acun A., Nguyen T.D, & Zorlutuna P. (2019). In vitro aged, hiPSC-origin engineered heart tissue models with age-dependent functional deterioration to study myocardial infarction. Acta biomaterialia, 94, 372-391.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!