Abi 7900ht qpcr system

We extracted RNA with TRIzol reagent (Invitrogen) and synthesized cDNA using the pTRUEscript First Strand cDNA Synthesis Kit (Aidlab, Beijing, China). We conducted qRT-PCR using 2× SYBR Green qPCR Mix (Invitrogen) through an ABI 7900HT qPCR system (Thermo Fisher Scientific, Waltham, MA, USA). We detected expression fold-change by 2^−ΔΔCT method. qRT-PCR amplification was performed using primers: hsa_circ_0001869: forward: 5′-GAGCTGGATTATCAAGG-3′; reverse: 5′-GATCAATGGCGGAATAAGCAG-3′; miR-638: forward: 5′-AAGGGATCGCGGGCGGGT-3′; reverse: 5′-CAGTGCAGGGTCCGAGGT-3′; FOSL2: forward: 5′-GAGAGGAACAAGCTGGCTGC-3′; reverse: 5′-GCTTCTCCTTCTCCTTCTGC-3′; U6: forward: 5′-CTCGCTTCGGCAGCACA-3′; reverse: 5′-AACGCTTCATTTGCGT-3′; GAPDH: forward: 5′-AATCCCATCACCATCTTCC-3′; reverse: 5′-CATCACGCCACAGTTTCC-3′. FOSL2 and hsa_circ_0001869 expression levels were normalized to GAPDH and miR-638 expression level was normalized to U6.

We extracted RNA using TRIzol reagent (Invitrogen) and synthesized cDNA with a pTRUEscript First Strand cDNA Synthesis Kit (Aidlab, Beijing, China). We performed qRT-PCR with 2× SYBR Green qPCR Mix (Invitrogen) with the ABI 7900HT qPCR system (Thermo Fisher Scientific, Waltham, MA, USA). We determined fold-changes in expression via the 2^−ΔΔCT method. We performed qRT-PCR amplification with the following primers: hsa_circ_0101145: forward, 5’- GAGCTGGA TTATCAAGG -3’, reverse, 5’- GATCAATGGCGG AATAAGCAG -3’; miR-548c-3p: forward, 5’- ACACTC CAGCTGGGCAAAAATCTCAAT -3’, reverse, 5’- CTC AACTGGTGTCGTGGA -3’; LAMC2: forward, 5’- TAC CAGAGCCAAGAACGCTG -3’, reverse, 5’- CGCAGTT GGCTGTTGATCTG -3’; U6: forward, 5’- CTCGCTTCG GCAGCACA -3’, reverse, 5’- AACGCTTCATTTGCGT -3’; and glyceraldehyde 3-phosphate dehydrogenase (GAPDH): forward, 5’- AATCCCATCACCATCTTCC- 3’, reverse: 5’- CATCACGCCACAGTTTCC -3’. We normalized LAMC2 and hsa_circ_0101145 expression levels to GAPDH; and miR-548c-3p expression to U6.

Mutations found with NGS were validated by Sanger sequencing. Furthermore, eight selected variants, namely 172_175del4, c.347insT, c.509_510delGA, Gln559Arg, Glu672Gln, Leu939Trp, Gly998Glu, and Thr1100Thr were analyzed using TaqMan SNP Genotyping Assays (Thermo) on an ABI 7900HT qPCR system (Thermo), as previously described [28 (link)].

Technician gained RNA via TRIzol reagent (Lot: 15,596–026; Invitrogen) and cDNA was synthesized via pTRUEscript First Strand cDNA Synthesis Kit (Lot: 170–8890; Aidlab, Beijing, China). Our team did qRT-qPCR with 2 × SYBR Green qPCR Mix (Lot: PC3301; Invitrogen) using ABI 7900HT qPCR system (Thermo Fisher Scientific, Waltham, MA, USA) and measured expression fold-change following the 2^−ΔΔCT method. Technician performed qRT-PCR amplification with following primers: circ-ARAP2 forward: 5′-GTACCAGAGATTCCAGGGTC-3′, reverse: 5′-CTTCACAGTACTGCTTTAC-3′; miR-761 forward: 5′-ACAGCAGGCACAGAC-3′, reverse: 5′-GAGCAGGCTGGAGAA-3′; FOXM1 forward: 5′-ACGTCCCCAAGCCAGGCTC-3′, reverse: 5′-CTATGTAGCTCAGGAATAA-3′; U6 forward: 5′-CTCGCTTCGGCAGCACA-3′, reverse: 5′-AACGCTTCATTTGCGT-3′; GAPDH forward: 5′-AATCCCATCACCATCTTCC-3′, reverse: 5′-CATCACGCCACAGTTTCC-3′. We normalized FOXM1 and circ-ARAP2 expression levels to GAPDH, and normalized the miR-761 expression level to U6.

The quantitative real-time PCR was performed on an ABI-7900HT qPCR system (Applied Biosystems, Foster City, CA, USA) using FG POWER SYBR GEREEN PCR MASTER MIX (Applied Biosystems, Foster City, CA, USA). The quantification of the PCR products of Ghrelin and GHR genes was evaluated in comparison with the PCR products of β-actin. The relative changes in mRNA expression levels determined from qPCR were calculated according to the 2^−△△CT method57 (link), where −ΔΔCT = −(ΔCT _{other tissue samples} − ΔCT _{duodenum sample at d0}) and ΔCT = CT _samples − CT _β-actin.

Isolation of RNA and cDNA preparation from the collected ileal mucosa samples was carried out according to Ran et al. (2016) (link). Expression levels of target genes related to immune and barrier functions in ileal tissue were determined by real-time PCR, which was performed on an ABI-7900HT qPCR system (Applied Biosystems, Foster City, United States) using FG Power SYBR Green PCR Master Mix (Applied Biosystems). Primer sequences for the target and internal reference genes are presented in Table 2. A melt curve analysis was performed for each gene at the end of the PCR run. The expression level for each gene was calculated after its cycle threshold (Ct) was normalized to the Ct for β-actin using the 2−^ΔΔCt method (Livak and Schmittgen, 2001 (link)).