PCR was conducted by using primers RTHW1F and RTHW1R (10 (link)) in 25-μL volumes; each final reaction contained 1× CoralLoad PCR Buffer (QIAGEN Pty Ltd, Hilden, Germany), 12.5 pmol of each primer, 0.5 U of HotStar Taq DNA Polymerase (QIAGEN), and 2 μL of DNA. The cycling conditions were the same as the published protocol (10 (link)) except for an initial denaturation of 5 min at 95°C. A positive control of N. americanus and A. ceylanicum hookworms and negative controls of distilled water were included in each run. PCR amplicons that were ≈380 bp in size, corresponding to Ancylostoma spp. hookworms, were purified by using the PureLink Quick PCR Purification Kit (Life Technologies, Carlsbad, CA, USA) and submitted to the University of Queensland Animal Genetics Laboratory, Gatton, for bidirectional DNA sequencing.
Purelink quick pcr purification kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
The PureLink Quick PCR Purification Kit is a laboratory tool designed to efficiently purify PCR amplicons. It provides a rapid and convenient method for removing unwanted components, such as primers, nucleotides, and salts, from PCR reactions, preparing the amplified DNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (5 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Quick rna miniprep kit, by Zymo Research (2 mentions)
Hotstartaq dna polymerase, by Qiagen (1 mentions)
Coralload pcr buffer, by Qiagen (1 mentions)
T4 ligase, by Promega (1 mentions)
Pd 10 column, by Cytiva (1 mentions)
Genomic dna mini kit, by Thermo Fisher Scientific (1 mentions)
Bca 1 kit, by Merck Group (1 mentions)
Synergy 2 microplate reader, by Agilent Technologies (1 mentions)
Taq dna polymerase, by New England Biolabs (1 mentions)
Purelink genomic dna mini kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Q5 high fidelity polymerase, by New England Biolabs (1 mentions)
2720 thermal cycler, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Purelink mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Microrna lna pcr primer set, by Qiagen (1 mentions)
Lightcycler 2, by Roche (1 mentions)
Mircury lna universal rt microrna pcr, by Qiagen (1 mentions)
34 protocols using purelink quick pcr purification kit
1
Hookworm species identification by PCR
2
Standard Molecular Biology Methods
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard methods were used throughout [25 ]. Genomic DNA, plasmid and PCR products were isolated using the Genomic DNA mini kit (Life Technologies, Carlsbad, CA, USA), the Purelink Plasmid DNA miniprep kit and the Purelink Quick PCR Purification Kit (both Life Technologies, Carlsbad, CA, USA), respectively, accordingly to the manufacturer’s protocols. Restriction enzymes were from Life Technologies or NEB, T4 ligase from Promega (Madison, WI, USA) or Life Technologies. SDS-PAGE used the method of [26 (link)], desalting of protein samples used PD-10 columns (Cytiva, Marlborough, MA, USA), and BCA protein determinations (BCA-1 kit, Sigma Aldrich, St. Louis, MO, USA) were performed according to the manufacturer’s protocol.
3
Synthesis of DIG-Labelled RNA Probes for FISH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain a template for synthesizing DIG-labelled RNA probes for use in FISH, a 373 bp fragment of the A. aegypti CAPA partial mRNA (GenBank Accession: XM_001650839) previously described50 (link) and a 743 bp product of the anti-diuretic hormone receptor identified herein with primers designed (see Table S3 ) using the Primer3 plugin in Geneious® 6.1.8 (Biomatters Ltd., Auckland, New Zealand) were amplified using standard Taq DNA Polymerase (New England Biolabs, Whitby, ON) following manufacturer- recommended conditions. PCR products were column-purified with PureLink Quick PCR Purification Kit (Life Technologies, Burlington, ON) and amplified in a subsequent PCR reaction to generate cDNA products with incorporated T7 promoter sequence (see Table S1 ) to facilitate in vitro RNA synthesis of anti-sense or sense probes. The final purified PCR products for use as templates for RNA probe synthesis were quantified on a SYNERGY 2 Microplate reader (Biotek, Winooski, VT).
4
Genotyping of Genetic Variants
5
Chikungunya Virus Genome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Parental CHIKV viruses (original stocks received from suppliers), single-passaged CHIKV in Vero cells (CHIKVvero) or mosquito cells (CHIKVmos), and single-passaged CHIKVvero and CHIKVmos in NIH3T3 cells were subjected to RNA isolation using RNeasy Mini Kit (Qiagen). cDNA was prepared using the iScript cDNA synthesis kit (Bio-Rad). Complete CHIKV E2 gene was amplified using a Q5 high fidelity polymerase (New England Biolab). The PCR primers were used according to a previous report [38 (link)]. The PCR fragments were purified by PureLink quick PCR Purification Kit (Life Technologies) and sequenced by Functional Biolab.
6
Cardiac miRNA Profiling: Isolation, Quantification, and Normalization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Left ventricle portion of heart was homogenized in a proprietary buffer and miRNA was isolated using commercially available kits (PureLink™ miRNA Isolation kit, Cat# K1570-01, Invitrogen, CA, USA for heart and miRCURY RNA Isolation Kit-Biofluids, Cat#300112, Exiqon, MA, USA for plasma), cDNA was synthesized using miRCURY LNA™ Universal RT microRNA PCR, Cat#203301, Exiqon, MA, USA in 2720 Thermal Cycler (Applied Biosystems, CA, USA), purified using PureLink™ Quick PCR Purification Kit, (Cat# K310001,Invitrogen, Poststraβe, Germany) and PCR was run in LightCycler 2.0 (Roche, Basel, Switzerland) using readymade specific forward and reverse primer mix (TaqMan® MicroRNA Assays, Applied Biosystems, CA, USA; microRNA LNA™ PCR primer sets, Exiqon, MA, USA) and the amplification curves were analyzed using 2-ΔΔCt method. Micro RNAs quantified were hsa-miR-25-3p (Cat# 204361), mmu-miR-155-5p (Cat# 205930), hsa-miR-99b-3p (Cat# 204064) and mmu-miR-451(Cat# 204734) and normalized with RNU5G (a small nuclear RNA) in heart and hsa-miR-30e-5p (Cat# 204714) in plasma.
7
Generating Mutated Recombinant NS1 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Site-directed mutagenesis was performed to generate mutated recombinant NS1 (rNS1). Primers were designed to mutate residues in regions of NS1 with high sequence similarity to other members of the Flaviviridae family (Table S1 ). PCR was performed using a reaction consisting of 20 ng wild-type plasmid template, 0.5 µM forward and reverse primers, 1X Pfx AccuPrime Reaction Mix, 2.5 units AccuPrime Pfx polymerase (ThermoFisher, Waltham, MA, USA). Reaction conditions consisted of 1 cycle of initial denaturation of 95 °C for 5 min, 12 cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 1 min, and extension at 68 °C for 8 min. This was followed by a final annealing step of 56 °C for 1 min, and a final extension of 68 °C for 30 min. The PCR products were treated with DpnI (ThermoFisher, Waltham, MA, USA) for 1 h and purified using PureLink Quick PCR purification Kit (Invitrogen, Darmstadt, Germany). Purified products were then transformed into JM109 (Promega, Madison, WI, USA) or DH5α (Invitrogen, Waltham, MA, USA) cells via heat shock and plated for overnight incubation on LB agar containing 100 µg/mL carbenicillin at 37 °C. Colonies were picked and screened by PCR.
8
POLE Mutation Screening in FFPE Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from formalin-fixed paraffin-embedded tumor tissues using a QIAamp DNA FFPE mini KIT (QIAGEN, Germantown, MD, USA). POLE exonuclease domain mutation screening of hotspots in exons 9 (c.857C>G, p.P286R; c.890C>T, p.S297F), 13 (c.1231G>C, p.V411L), and 14 (c.1366G>C, p.A456P) was performed using Sanger sequencing. The following primers were used: Ex 9F (5 to 3), GCCTAATGGGGAGTTTAGAGC; Ex 9R (5 to 3), ATGCTGCTGTAGTATGGGGA; Ex 13F (5 to 3), TGCCTGTTAGGAACTTGCAT; Ex 13R (5 to 3), CACATGTCCTCCGGGTCTA; Ex 14F (5 to 3), TCTCCTTACTGTGTGTGCGG; Ex 14R (5 to 3), TCGGGCTCCATGGGAATAA. Polymerase chain reaction (PCR) was performed with 20-ng DNA input using AmpliTaq Gold 360 Master Mix (Applied Biosystems; Thermo Fisher Scientific). Subsequently, amplified PCR products were enzymatically purified using the PureLink Quick PCR Purification Kit (Invitrogen; Thermo Fisher Scientific) and bidirectionally sequenced using a BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems; Thermo Fisher Scientific). Mutation analysis was performed using the Variant Reporter Software ver. 2.0 (Applied Biosystems; Thermo Fisher Scientific) and manual inspection.
9
KLK2-FGFR2 Fusion Detection
10
PCR Amplicon Sequencing Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were purified using PureLink Quick PCR Purification Kit (Invitrogen, Carlsbad, CA, USA) and subjected to double-strand DNA sequencing to cover the entire amplicon using a set of sequencing primers (Table 6 ). The sequencing reactions were carried out using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) per manufacturer’s instructions, followed by capillary electrophoresis performed on an Applied Biosystems PRISM 3730 Genetic Analyzer at the UNMC DNA Sequencing Core facility. Sequences of the primers used for DNA sequencing are described in Table 6 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!