The CMV-hspCas9-EF1-GFP lentiviral vector plasmid was purchased from System Biosciences (Catalog # CASLV105PA-1) and expressed the human codon-usage optimized S. pyogenes Cas9 from the human cytomegalovirus (CMV) promoter (Supplementary Figure S4C ). It also expressed the green fluorescent protein (GFP) as reporter from the elongation factor 1α promoter (EF1α). The DNA encoding the 5′-CTGrepeat-gRNA and 3′-CTGrepeat-gRNA (Supplementary Table S1 ) were synthesized as oligonucleotides, annealed and cloned into MLM3636 (Addgene plasmid ID # 43860). The choice of gRNAs was based on the presence of PAM consensus sequences that were in close proximity to the expanded CTG repeat. Moreover, gRNA were selected based on computational strategies to also minimize the risk of off-target effects, as described in Fu et al. (39 (link),40 (link)). The gRNA expression cassette composed of the pol III U6 promoter-gRNA-scaffold, which was then PCR-amplified with BsiWI and SpeI flanking restriction enzyme sites and cloned into a lentiviral vector backbone (41 (link)) along with Blue fluorescent protein (BFP; Evrogen; FP172) a reporter expressed under cytomegalovirus (CMV) promoter (Supplementary Figures S4C and S5A ). The scrambled gRNA cassette was amplified from commercially available plasmid (Origine, GE100021) and cloned into the lentiviral vector backbone as described above.
Mlm3636
Manufactured by Addgene
The MLM3636 is a laboratory equipment product. It serves a core function, but a detailed description while maintaining an unbiased and factual approach is not available.
Automatically generated - may contain errors
Lab products found in correlation
Pmlm3636, by Addgene (1 mentions)
Pcs2 ncas9n, by Addgene (1 mentions)
Spcas9, by Addgene (1 mentions)
Lenticrispr v2, by Addgene (1 mentions)
Nucaway spin column, by Thermo Fisher Scientific (1 mentions)
T7 rna polymerase, by Roche (1 mentions)
Hcas9 vector, by Addgene (1 mentions)
Sgrna ms2, by Addgene (1 mentions)
Pcas9 gfp, by Addgene (1 mentions)
Genejuice transfection reagent, by Merck Group (1 mentions)
Jds246, by Addgene (1 mentions)
4d nucleofector system, by Lonza (1 mentions)
13 protocols using mlm3636
1
Lentiviral Delivery of Cas9 and gRNA for Expanded CTG Repeat
2
CRISPR sgRNA Design and Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target sequences were entered into the MIT sgRNA design software (http://crispr.mit.edu/ ), the BROAD sgRNA design tool (http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design-v1 ) (Doench et al., 2014 (link)), and the sgRNAcas9 tool (version 2.0.10) (Xie et al., 2014 (link)). The intersection of sgRNA target sites produced by all tools was taken for further analysis. sgRNA sequences that failed the BROAD test (score<0.2) were excluded. sgRNA were selected based on high BROAD scores and location relative to other sgRNAs. sgRNA coordinates and sequences are in Tables S1 and S2 . Oligonucleotides corresponding to the target sites were annealed and cloned into MLM3636 (Addgene plasmid #43860). For lentivirus plasmids, U6-sgRNA coding sequences were amplified from pMLM3636 by PCR and cloned into an EcoRI and ClaI linearized pLVTHM lentiviral backbone (Addgene plasmid #12247) generating pL-sgRNA1 and pL-sgRNA2 in which GFP is expressed from EF1a promoter.
3
CRISPR/Cas9 Zebrafish Mutagenesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 sgRNAs (sgRNA 1: GATCATAGCAGGGGATTCGG AGG, sgRNA2: GGAGTACATGGGTAAAAACA GGG) were designed using the CCTop tool 37 , cloned in the plasmid MLM3636 (Addgene #43860), and synthesized and purified as described elsewhere 38 .
The two sgRNAs were co‐injected at 120–150 ng/μl together with homemade 6.5 μM Cas9 protein‐produced from the pCS2‐nCas9n plasmid (Addgene #47929) in NEB Cas9 buffer (NEB #B0386A) into zebrafish 1‐cell‐stage embryos.
Founder animals were identified at 3 months post‐fertilization (mpf) by fin clip PCR analysis using the primers 5′TCCACTCTGCTTACTTCACAC3′ and 5′TTTGCTTTGTCTGTATGTCCTG3′ and were crossed with AB wild‐type fish to generate F1 progeny. PCR products from the mutant allele of the F1 heterozygous were purified from gel bands (NEB #T1020S) and analyzed by Sanger sequencing. Two lines derived from different injection rounds and progenitors with two different deletions were established: scaf1Δ1 and scaf1Δ2 (deposited in Zfin as cox7a3brn1 and cox7a3brn2, respectively).
Genotyping during line maintenance used the described primers. All experiments were performed comparing scaf1Δ1/Δ1 and scaf1Δ2/Δ2 with their respective wild‐type sibling lines coming from the same founder and AB mating. A maximum of four in‐cross generations were used for the experiments.
The two sgRNAs were co‐injected at 120–150 ng/μl together with homemade 6.5 μM Cas9 protein‐produced from the pCS2‐nCas9n plasmid (Addgene #47929) in NEB Cas9 buffer (NEB #B0386A) into zebrafish 1‐cell‐stage embryos.
Founder animals were identified at 3 months post‐fertilization (mpf) by fin clip PCR analysis using the primers 5′TCCACTCTGCTTACTTCACAC3′ and 5′TTTGCTTTGTCTGTATGTCCTG3′ and were crossed with AB wild‐type fish to generate F1 progeny. PCR products from the mutant allele of the F1 heterozygous were purified from gel bands (NEB #T1020S) and analyzed by Sanger sequencing. Two lines derived from different injection rounds and progenitors with two different deletions were established: scaf1Δ1 and scaf1Δ2 (deposited in Zfin as cox7a3brn1 and cox7a3brn2, respectively).
Genotyping during line maintenance used the described primers. All experiments were performed comparing scaf1Δ1/Δ1 and scaf1Δ2/Δ2 with their respective wild‐type sibling lines coming from the same founder and AB mating. A maximum of four in‐cross generations were used for the experiments.
4
CRISPR/Cas9 Targeting of COL7A1 in RDEB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
gRNAs were designed using the ZiFiT Targeter 4.2 (http://zifit.partners.org ) online software. Five gRNA (N1–N5) sequences targeting COL7A1 (Table S1 ) were cloned into the plasmid MLM3636 (Addgene 43860) according to the available guidelines. The activity of gRNAs was tested using the plasmid PX165 encoding for the human codon-optimized Cas9 nuclease from Streptococcus pyogenes (SpCas9) (Addgene 48137). Selected gRNAs displaying activity in HEK293T cells were cloned into the plasmid lentiCRISPR_v2 (Addgene 52961) according to the available guidelines to efficiently transduce RDEB-Ks and RDEB-Fs. The LV-Donor lentiviral vector, used for gene-targeting experiments, was described previously.16 (link)
5
Mouse Tyr CRISPR Genome Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Repeat-masked sequences in the region 5′ upstream of the mouse Tyr gene were scanned using the online tool crispr.mit.edu . Top scoring sgRNA sequences and related off-target sites were retrieved. CRISPR–Cas9 reagents were prepared as reported (41 (link)). Briefly, the Cas9 coding sequence was obtained from the hCas9 vector (Addgene, #41815) and PCR amplified with the oligonucleotides T7-Cas9Fw (which includes the T7 RNA polymerase promoter) and Cas9Rv (Supplementary Table S1). One microgram of purified PCR product was used for RNA in vitro transcription using the mMessage mMachine Ultra T7 Kit (Ambion). Two complementary oligonucleotides were designed carrying 20 bp of the target site and Esp3I-compatible overhangs as reported previously, annealed in vitro and cloned by Golden Gate Cloning in the Esp3I sites of the sgRNA expression vector MLM3636 (Addgene, #43860). A PCR product of the sgRNA cassette was used for RNA transcription using T7 RNA polymerase (Roche) with no further capping or polyA-tailing reactions. Both Cas9 and sgRNA were purified using Nucaway Spin Columns (Ambion) and rehydrated in sterile RNAse-free microinjection buffer (1 mM Tris–HCl pH 7.5, 0.1 mM EDTA pH 7.5).
6
CRISPR/Cas9 Targeting of Genomic L1 Elements
7
Efficient Cas9/gRNA Transfection in MSCs
8
CRISPR Targeting of ATRX Exon 9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ATRX cDNA was screened by ZiFiT to determine a CRISPR target in exon 9 of ATRX [37 (link)]. Two complementary oligos were designed by ZiFit, ATRXex9_1 and ATRXex9_2 (Supplementary Table 1 ), and were subsequently annealed and ligated into a CRISPR RNA expression plasmid (MLM3636; Addgene). The resulting plasmid was co-transfected with a Cas9 nuclease expression plasmid (41815; Addgene) into wild-type HCT116. Cells were subcloned, and screened for correct targeting by interrogating the disruption of an SmlI restriction enzyme site that lies directly adjacent to the target sequence cut by the Cas9 endonuclease. Targeting PCR was performed using ATRXex9F and ATRXex9R (Supplementary Table 1 ), and products were subjected to SmlI digestion. Sanger sequencing of the correctly modified clones was performed with ATRXex9SeqF to confirm that an early stop codon was inserted or a frame-shift mutation had occurred.
9
CRISPR/Cas9 Gene Disruption Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 gRNAs were designed using using zifit.partners.org. The oligos 5’ ACACCGCATCAACACTGGCACGAGCG 3ʹ and 5ʹ AAAACGCTCGTGCCAGTGTTGATGCG 3ʹ were annealed and cloned into the vector MLM3636 (Addgene #43,860) cut with BsmBI. The CRISPR gRNA plasmid was transfected with the JDS246 (Addgene plasmid #43,861) a mammalian codon optimized Cas9 nuclease with C-term 3X FLAG, using Genejuice transfection reagent (Merck) according to the manufacturer’s instructions. Clonal cell lines were isolated by limiting dilution. Genomic DNA was isolated using DirectPCR lysis buffer (Viagen). Gene disruption was analysed by PCR using primers spanning the CRISPR gRNA binding region Sense 5ʹ- aaagtctgttgcttgtgtttca- 3ʹ and Antisense 5ʹ taccagaatttgtagactgcgt- 3ʹ and a PCR control region downstream of the CRISPR gRNA binding site to check quality of the genomic DNA preparations. Sequencing reactions were performed using the custom primer 5ʹ tgacaactaaagcaccgcac 3ʹ.
10
CRISPR-Cas9 Gene Editing in hESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene-editing experiments were performed as previously described (97 (link)). Briefly, guide RNA sequences were generated with the CRISPR design tool (http://crispr.mit.edu/ ). Two gRNAs were selected: 5’-GTCGTCGGCAAAGGCGGGTT-3’ and 5’-GCAGTGTTCCGGGCGCAACAT-3’. Forward and reverse oligonucleotides for the gRNAs were then inserted into the MLM3636 vector (a gift from K. Joung, Addgene, no. 43860). The activity of the gRNAs was assessed in HEK293T cells. We then transfected two million H9 human embryonic stem cells (hESCs) with 20 μg Cas9-GFP plasmid and 5 μg gRNA plasmid mixed in electroporation buffer (BTX, no.45–0805). Cells were sorted by FACS, on the basis of GFP signals, 48 hours after electroporation. We replated 50,000 cells with a moderate GFP fluorescence intensity and cultured them for 72 h. The cells were then detached with Accutase, counted and plated at clonal density in 96-well plates. Ten days later, the colonies were passaged and amplified. Genomic DNA was then extracted from each single-cell clone and genotyping was performed by Sanger sequencing with the following primers: Forward: 5’-AGAGGCGCCTATAAGGGAAGT-3’ and Reverse: 5’-TACACTCCAGGAGAGAGCTGG-3’.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!