Sh zfas1

ZFAS1 pcDNA3.1 vector (ZFAS1), RALY pcDNA3.1 vector (RALY) and empty vector (vector) were subcloned into the vector pcDNA3.1 (Invitrogen, Carlsbad, CA, United States). miR-193a-3p mimic, negative control oligonucleotides (mimic-NC), miR-193a-3p inhibitor, negative control oligonucleotide (NC inhibitor), small interfering RNA of ZFAS1 or RALY (si-ZFAS1, si-RALY) and scramble siRNA of ZFAS1 or RALY (siSCR) were purchased from RiboBio (Guangzhou, China). Cells were transfected using lipofectamine 2000 (Thermo Fisher, CA, United States) following to the manufacturer’s protocols. qRT-PCR was performed at 48–72 h later to determine the transfection efficiency. For further in vivo experiments, sh-ZFAS1 and sh-SCR were obtained from RiboBio (Guangzhou, China) and constructed into HB cell lines.

Full length of ZFAS1 or adaptor-associated kinase 1 (AAK1) sequence was synthesized by RiboBio (Guangzhou, China) and inserted into the pcDNA3.1 vector (V79020; Invitrogen, CA, USA) to generate pcDNA/ZFAS1 or pcDNA/AAK1. The miR-4711-5p mimics (UGCAUCAGGCCAGAAGACAUGAG), control miRNA mimics (NC mimics; AAACACUUCAAGAGGGGUCCAUA), as well as shRNA targeting ZFAS1 (sh-ZFAS1; GAATATATATATACATATA) and scrambled control (sh-NC; TATATGTATATATATATTC) were obtained from RiboBio (Guangzhou, China). NP cells were seeded into 24-well plates at 1 × 10⁷ cells/well, and then 2 µg vectors or 50 nM synthetic oligonucleotides were transfected into NP cells. Transfection was performed by using Lipofectamine 2000 (11668; Invitrogen) according to the manufacturer’s protocol [19 (link),20 (link)].