Stable shRNA-expressing cell lines were generated using MISSION shRNA lentiviruses (Sigma). The sequences of shRNA for targeting human PARP9 were CCGGGCAGGTTCTAAAGGTGGAGAACTCGAGTTCTCCACCTTTAGAACCTGCTTTTTG (PARP9-1) and CCGGGCAAAGTCAATTCTACAACAACTCGAGTTGTTGTAGAATTGACTTTG-CTTTTTG (PARP9-2) and for DTX3L were CCGATGGACATTGATAGCGATCTCGAGATCGCTATCAA-TGTCCATCGGTTTTTG (DTX3L-1) and TTAGAGGTGGGTCCGAAATAACTCGAGTTATTTC-GGACCCACCTCTAATTTTTG (DTX3L-2). The Mission non-target shRNA vector was used as a control (Sigma). At 48 h after lentiviral inoculation, cells were selected with puromycin (1 μg/ml) to establish stable cell lines. Gene knockdown was assessed using real-time PCR assay and Immunoblotting.
Mission non target shrna vector
Manufactured by Merck Group
The Mission non-target shRNA vector is a plasmid-based tool used in RNA interference studies. It contains a cassette for the expression of a non-targeting short hairpin RNA (shRNA) sequence, which can be used as a control in experiments involving RNA silencing.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using mission non target shrna vector
1
Stable shRNA-mediated knockdown of PARP9 and DTX3L
2
Generating Stable shRNA-Expressing Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stable shRNA-expressing cell lines were generated with MISSION shRNA lentiviruses (Sigma). The sequences of shRNA for targeting human PARP9 were CCGGGCAGGTTCTAAAGGTGGAGAACTCGAGTTCTCCACCTTTAGAACCTGCTTTTTG (PARP9-1) and CCGGGCAAAGTCAATTCTACAACAACTCGAGTTGTTGTAGAATTGACTTTG-CTTTTTG (PARP9-2), and for DTX3L, they were CCGATGGACATTGATAGCGATCTCGAGATCGCTATCAA-TGTCCATCGGTTTTTG (DTX3L-1) and TTAGAGGTGGGTCCGAAATAACTCGAGTTATTTC-GGACCCACCTCTAATTTTTG (DTX3L-2). The Mission non-target shRNA vector was used as a control (Sigma). At 48 h after lentiviral inoculation, cells were selected with puromycin (1 μg/ml) to establish stable cell lines. Gene knockdown was assessed by real-time PCR assay and Immunoblot analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!