Mimic control duplexes

siRNAs targeted to circMGAT5 (si-circFGFR2, 5′-AGCTTAATGTAGCAGGATG-3′) or a non-specific siRNA negative control, miR-132c-5p mimic, mimic control duplexes, miR-132c-5p inhibitor, inhibitor control, the 3′ end biotinylated miR-132c-5p mimic (AGCCAUGACUGUAGACUGUUACU) and control duplexes used in this study were synthetized by RiboBio (Guangzhou, China).
For circMGAT5 overexpression plasmid construction, the linear sequence of circMGAT5 was amplified and cloned into the pCD25-ciR expression vector. For pmirGLO-circMGAT5-wild/pmirGLO-circMGAT5-mutant reporter and pmirGLO-MMD-wild/pmirGLO-MMD-mutant reporter construction, the corresponding wild sequence and the mutant sequence were synthetized by Tsingke Biotechnology (Beijing, China) and then cloned into the pmirGLO expression vector.

The miR-20a-5p mimic, miR-20b-5p mimic, mimic control duplexes, miR-20a-5p inhibitor, miR-20b-5p inhibitor and inhibitor NC were purchased from RiboBio. siRNA against E2F1 was purchased from GenePharma. Lipofectamine 3000 reagent (Invitrogen) was used for transfection according to the manufacturer’s instructions. 50 nM miRNA mimics, 100 nM miRNA inhibitor (as well as the mixed inhibitors) or 100 nM siRNA was used in the transfection assay.