Pl crispr

Manufactured by Addgene

The PL-CRISPR is a lab equipment product designed for CRISPR-based genome editing applications. It provides the core functionality required for CRISPR experiments, enabling researchers to perform essential tasks in their research workflows.

Automatically generated - may contain errors

Lab products found in correlation

Tet plko puro, by Addgene (1 mentions) Lenticas9 blast, by Addgene (1 mentions) Lzrs ires gfp, by Addgene (1 mentions) Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions) Pklv2.2 h7skgrna5 sapi hu6grna5 bbsi pgkpurobfp w, by Addgene (1 mentions) Lenticrispr v2, by Addgene (1 mentions) Plko5 sgrna efs gfp, by Addgene (1 mentions)

3 protocols using pl crispr

Generating Genetically Modified Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MYD88 coding sequence was subcloned into LZRS-IRES-GFP (Addgene plasmid #21961). Subsequently, the QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, California, USA) was utilized to generate the MYD88 mutant constructs according to the manufacturer’s instructions. Mutants were confirmed by Sanger sequencing. To generate doxycycline-inducible MYD88 knockdown cell lines, we inserted an shRNA targeting MYD88 (GCAGAGCAAGGAATGTGACTT or GACCCAATGTACCAGTATT) into Tet-pLKO-puro (Addgene plasmid #21915). To generate MYD88 knockout cells, we inserted a single guide RNA targeting MYD88 (CTGCTCTCAACATGCGAGTG or CTCGAGCAGTCGGCCTACAG) into pL-CRISPR.EFS.GFP (Addgene plasmid #57818). For generation of stable Cas9 expressing cell lines, we used lentiCas9-Blast (Addgene plasmid #52962). MSCV-CA-IKK2-IRES-GFP was kindly provided by Dr J. Schuringa (University of Groningen, Groningen, The Netherlands).

Minderman M., Lantermans H., van der Zwaan C., Hoogendijk A.J., van den Biggelaar M., Kersten M.J., Spaargaren M, & Pals S.T. (2023). The oncogenic human B-cell lymphoma MYD88 L265P mutation genocopies activation by phosphorylation at the Toll/interleukin-1 receptor (TIR) domain. Blood Cancer Journal, 13(1), 125.

+ Open protocol

+ Expand

Single gRNA CRISPR Plasmid Cloning

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Single gRNAs targeting the miRNA regions were cloned into LentiCRISPR V2 (a gift from Feng Zhang, Addgene plasmid #52961) or pKLV2.2-h7SKgRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W (Addgene plasmid # 72666) or pKLV2.2-mU6gRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W (Addgene no#72666) (gifts from Kosuke Yusa) (Tzelepis et al., 2016 (link); Ihry et al., 2018 (link)). The gRNAs were cloned at the BsmBI site for LentiCRISPR V2 plasmid and SapI or BbsI sites for the pKLV2.2 plasmids as previously described (Sanjana et al., 2014 (link); Tzelepis et al., 2016 (link)). Single gRNAs targeting the γ globin promoter region were cloned into pL.CRISPR.EFS.GFP (Addgene plasmid #57818) (gift from Benjamin Ebert) at the BsmBI site (Heckl et al., 2014 (link)).

Ijee S., Chambayil K., Chaudhury A.D., Bagchi A., Modak K., Das S., Benjamin E.S., Rani S., Paul D.Z., Nath A., Roy D., Palani D., Priyanka S., Ravichandran R., Kumary B.K., Sivamani Y., S. V., Babu D., Nakamura Y., Thamodaran V., Balasubramanian P, & Velayudhan S.R. (2024). Efficient deletion of microRNAs using CRISPR/Cas9 with dual guide RNAs. Frontiers in Molecular Biosciences, 10, 1295507.

+ Open protocol

+ Expand

CRISPR-Mediated Inactivation of CCL2 and CCR2 in Human Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exon 1 of human CCL2 was targeted by CRISPR/Cas9 using the gRNA: 5’-GTACCTGGCTGAGCGAGCCCT-3’. The gRNA was cloned into lentivirus vector pLKO5.sgRNA.EFS.GFP (Addgene, cat #57822). hCAF-1 was transfected with lentivirus containing Cas9 and a blasticidin selection marker (Addgene, cat #52962). Cells were selected with 4 μg/ml blasticidin. Cells were transduced with lentivirus expressing CCL2 gRNA or control vector, flow sorted for GFP expression, and seeded into 96-well plates. Single cell colonies were screened by CCL2 ELISA to identify CCL2 deficient clones. CCR2 was targeted by CRISPR/Cas9 with gRNA: 5’TTCACAGGGCTGTATCACAT-3’. The gRNA was cloned into the pL-CRISPR.EFS.GFP vector [86] (Addgene, cat #57818), a lentivirus vector containing Cas9 and a GFP reporter. Transduced cells were flow sorted for GFP expression and seeded into 6-well plates, 1000 cells/well. Individual colonies were manually picked and seeded into 96-well plates. Colonies were screened for CCR2 gene alterations by PCR, using primers flanking the targeting site (primer-F:ACATGCTGGTCGTCCTCATC and primer-R: AAACCAGCCGAGACTTCCTG). Wildtype and CCR2 mutant clones were confirmed by DNA sequencing.

Yao M., Fang W., Smart C., Hu Q., Huang S., Alvarez N., Fields P, & Cheng N. (2018). CCR2 chemokine receptors enhance growth and cell cycle progression of breast cancer cells through SRC and PKC activation. Molecular cancer research : MCR, 17(2), 604-617.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!